معلومة

هل ستؤدي الطفرات الجينية إلى ظهور بروتين أقصر من البروتين كامل الطول؟

هل ستؤدي الطفرات الجينية إلى ظهور بروتين أقصر من البروتين كامل الطول؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ما العلاقة بين حذف أو إدخال النيوكليوتيدات في تسلسل الجين وطول البروتين المشفر من الجين المتحور؟


يعتمد ذلك على طبيعة الإدراج أو الحذف.

العديد من الطفرات نقطة الطفرات ، حيث يتم تغيير نوكليوتيد واحد:

ATGACTACGCTATTCAGT M T T L F S ATGTCTACGCTATTCAGT M S T L F S

لاحظ أن تغيير الرابع A إلى T تسبب في تغيير T-> S في البروتين النهائي ، ولم يغير طوله. ومع ذلك ، فإن الإدراج / الحذف مختلف. بدءًا من هذا التسلسل:

ATGTCTATTGACGCTATTCAG M S I D A I Q

لنحصل على إدخال ، A بعد A في الموضع 7:

توقف ATGTCTAATTGACGCTATTCAG M S N

لاحظ أن لدينا الآن رمز الإيقاف (TGA). هذا يعني أن البروتين سيتم اقتطاعه وسيكون أصغر بكثير. هذا ليس هو الحال دائمًا. بدلاً من إضافة A في الموضع 7 ، دعنا نضيفه بعد الموضع 9:

ATGTCTATTAGACGCTATTCA M S I R R Y S

يكون البروتين بنفس الطول تقريبًا ، لكن AAs مختلفة تمامًا عن الإصدار الأصلي بعد الإدخال:

M S I D A I Q M S I R R Y S

هذا يسمى طفرة الإطارات. من الناحية البيولوجية ، هذه الطفرات ضارة لأنها تغير جميع الأحماض الأمينية بعد الطفرة ، وغالبًا ما يكون البروتين غير فعال ويمكن أن ينتهي به الأمر بأحجام مختلفة (إذا كان كودون الإيقاف الآن في الإطار أو خارج الإطار) ويمكن أن ينتهي البروتين أيضًا حتى كونها غير مستقرة وسريعة التدهور.

لذلك ، للإجابة على سؤالك حول طول البروتين ، فإنه سيزيد / ينقص بمقدار AA واحد في كل مرة تتم فيها إضافة / إزالة 3 نيوكليوتيدات ، ولكن يمكن أن تزيد أو تنقص بشكل جذري إذا تمت إضافة كود التوقف أو إزالته بواسطة طفرة تغيير الإطارات.


ارتباط قوي بين آليات التولد الكاذب وطول تسلسل الجينات

تنشأ الجينات الكاذبة من اضمحلال نسخ الجينات بعد إما ازدواجية RNA بوساطة (الجينات الخادعة المعالجة) أو الازدواج بوساطة الحمض النووي (الجينات الخادعة غير المعالجة). هنا ، نظهر أن الجينات الطويلة المشفرة للبروتين تميل إلى إنتاج جينات خادعة غير معالجة أكثر من الجينات القصيرة ، في حين أن العكس هو الصحيح بالنسبة للجينات الخادعة المعالجة. تزيد احتمالية إنتاج جينات ترميز البروتين الأطول من 3000 زوج قاعدي 6 مرات للجينات الخادعة غير المعالجة مقارنة بالجينات المعالجة.

المراجعين

تمت مراجعة هذا المقال من قبل الدكتور دان جراور والدكتور كريج نيلسون (رشح من قبل الدكتور جي بيتر جوجارتن).


الملخص

قائمة الأمراض الوراثية التي تسببها الطفرات التي تؤثر على ترجمة الرنا المرسال تتزايد بسرعة. على الرغم من أن تخليق البروتين هو عملية أساسية في جميع الخلايا ، إلا أن الأنماط الظاهرية للمرض تظهر درجة مدهشة من عدم التجانس. قدمت الدراسات التي أجريت على بعض هذه الأمراض رؤى جديدة مثيرة للاهتمام حول وظائف البروتينات المشاركة في عملية الترجمة ، على سبيل المثال ، تشير الدلائل إلى أن العديد منها لها وظائف أخرى بالإضافة إلى أدوارها في الترجمة. بالنظر إلى البروتينات العديدة المشاركة في ترجمة mRNA ، فمن المحتمل أن المزيد من الأمراض الموروثة سوف يتضح أن سببها طفرات في الجينات التي تشارك في هذه العملية المعقدة.


مراجع

تايلور ، جي بي ، هاردي ، J. & amp Fischbeck ، K.H. البروتينات السامة في الأمراض التنكسية العصبية. علم 296, 1991–1995 (2002).

بيتس ، ج.تجمع هنتنغتين والسمية في مرض هنتنغتون. لانسيت 361, 1642–1644 (2003).

Caughey، B. & amp Lansbury، P. الألياف الأولية والمسام والألياف والتنكس العصبي: فصل تجمعات البروتين المسؤولة عن المتفرجين الأبرياء. Annu. القس نيوروسسي. 26, 267–298 (2003).

بيرك ، إس. & amp Paulson ، وتجميع البروتين HL ومسار البروتيازوم يوبيكويتين: اكتساب يد UPPer في التنكس العصبي. بالعملة. رأي. جينيه. ديف. 13, 253–261 (2003).

روس ، سي. & amp Pickart ، C. مسار اليوبيكويتين البروتيازومي في مرض باركنسون وأمراض التنكس العصبي الأخرى. اتجاهات خلية بيول. (2004).

Nussbaum ، R.L. & amp Ellis ، CE مرض الزهايمر ومرض باركنسون. إنجل. جيه ميد. 348, 1356–1364 (2003).

Wong، P.C.، Cai، H.، Borchelt، D.R. & أمبير السعر ، د. نماذج الفئران المعدلة وراثيا للأمراض التنكسية العصبية. نات. نيوروسسي. 5, 633–639 (2002).

روس ، سي. عندما يكون المزيد أقل: يؤدي التسبب في الجلوتامين إلى تكرار الأمراض التنكسية العصبية. عصبون 15, 493–496 (1995).

سيلكو ، دي جي. طي البروتينات بطرق قاتلة. طبيعة سجية 426, 900–904 (2003).

ديفيز ، إس دبليو. وآخرون. إن تكوين شوائب الخلايا العصبية داخل النواة يكمن وراء الخلل الوظيفي العصبي في الفئران المعدلة وراثيا لطفرة HD. زنزانة 90, 537–548 (1997).

شيرزينغر ، إي وآخرون. التجميع الذاتي لشظايا هنتنغتين المحتوية على البولي جلوتامين إلى ألياف شبيهة بالأميلويد: الآثار المترتبة على أمراض مرض هنتنغتون. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 96, 4604–4609 (1999).

فونساتيل ، جي بي وآخرون. التصنيف المرضي العصبي لمرض هنتنغتون. J. نيوروباتول. إكسب. نيورول. 44, 559–577 (1985).

كوميرل ، إس وآخرون. قد لا تتنبأ مجاميع هنتنغتون بموت الخلايا العصبية في مرض هنتنغتون. آن. نيورول. 46, 842–849 (1999).

جوتكونست ، كاليفورنيا. وآخرون. المجاميع النووية والعصبية في مرض هنتنغتون: العلاقة مع علم الأعصاب. J. نيوروسسي. 19, 2522–2534 (1999).

بيشر ، ميغاواط وآخرون. شوائب الخلايا العصبية داخل النواة في مرض هنتنغتون وضمور الأسنان الحلقي والشاحن: الارتباط بين كثافة الادراج وطول تكرار IT15 CAG الثلاثي. نيوروبيول. ديس. 4, 387–397 (1998).

مايرز ، آر إتش وآخرون. التقييم السريري وعلم الأمراض العصبي لشدة مرض هنتنغتون. علم الأعصاب 38, 341–347 (1988).

Venkatraman، P.، Wetzel، R.، Tanaka، M.، Nukina، N. & amp Goldberg، L. مول. زنزانة 14, 95–104 (2004).

هوانغ ، سي. وآخرون. تكوين الأميلويد بواسطة هنتنغتين متحولة: عتبة ، تقدمية وتوظيف بروتينات بولي جلوتامين طبيعية. سومات. خلية مول. جينيه. 24, 217–233 (1998).

Kazantsev ، A. ، Preisinger ، E. ، Dranovsky ، A. ، Goldgaber ، D. & amp Housman ، D. تتشكل الركام غير القابل للذوبان المقاوم للمنظفات بين الأطوال المرضية وغير المرضية للبولي جلوتامين في خلايا الثدييات. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 96, 11404–11409 (1999).

Margolis، R.L. & amp Ross، C.A. انفجار التمدد: أدلة جديدة على التسبب في الأمراض التنكسية العصبية التوسعية المتكررة. اتجاهات مول. ميد. 7, 479–482 (2001).

أور ، إتش. & أمبير الزغبي ، H.Y. علم الوراثة الجزيئي SCA1: تاريخ من التعاون لمدة 13 عامًا ضد الجلوتامين. همم. مول. جينيه. 10, 2307–2311 (2001).

Sen، S.، Dash، D.، Pasha، S. & amp Brahmachari، S.K. دور انقطاع الهيستدين في التخفيف من الآثار المرضية للبولوتامين الطويل الممتد في SCA1: نهج جزيئي. علوم البروتين. 12, 953–962 (2003).

سيلكو ، دي جي. مرض الزهايمر هو فشل متشابك. علم 298, 789–791 (2002).

هاردي ، J. & amp Selkoe ، D.J. فرضية الأميلويد لمرض الزهايمر: التقدم والمشاكل على الطريق إلى العلاجات. علم 297, 353–356 (2002).

سيربيل ، إل. & amp Smith ، J.M. التصور المباشر لبنية صفائح β من أميلويد ألزهايمر الاصطناعي. جيه مول. بيول. 299, 225–231 (2000).

ايسلر ، دبليو بي. & أمبير وولف ، إم. صورة لإفرازات مرض الزهايمر - ملامح جديدة ووجوه مألوفة. علم 293, 1449–1454 (2001).

الكباد ومرض الزهايمر: العلاجات في الاكتشاف والتطوير. نات. نيوروسسي. 5 (ملحق) ، 1055-1057 (2002).

Goedert ، بروتين M. Tau والتنكس العصبي. سيمين. تطوير الخلية. بيول. 15, 45–49 (2004).

إنجرام ، إي إم وأمبير سبيلانتيني ، إم جي. الطفرات الجينية تاو: تشريح التسبب في FTDP – 17. اتجاهات مول. ميد. 8, 555–562 (2002).

فورنو ، إل. علم الأمراض العصبية لمرض باركنسون. J. نيوروباتول. إكسب. نيورول. 55, 259–272 (1996).

داوسون ، ت. & amp Dawson ، V.L. تلقي طفرات جينية نادرة الضوء على التسبب في مرض باركنسون. J. كلين. استثمار 111, 145–151 (2003).

فالنتي ، إي إم وآخرون. مرض باركنسون الوراثي المبكر الناجم عن الطفرات في PINK1. علم 304, 1158–1160 (2004).

كليفلاند ، د. & amp Rothstein ، JD From Charcot to Lou Gehrig: فك رموز موت الخلايا العصبية الحركية الانتقائية في ALS. نات. القس نيوروسسي. 2, 806–819 (2001).

بروين ، ل. وآخرون. التجميع وسمية الخلايا العصبية الحركية لمتحول SOD1 المرتبط بـ ALS المستقل عن النوع البري SOD1. علم 281, 1851–1854 (1998).

رخيت ، ر. وآخرون. الاختلال الناجم عن الأكسدة وتجميع ديسموتاز الفائق وآثاره على التصلب الجانبي الضموري. J. بيول. تشيم. 277, 47551–47556 (2002).

Prusiner ، S.B. محاضرة شاتوك - الأمراض التنكسية العصبية والبريونات. إنجل. جيه ميد. 344, 1516–1526 (2001).

Lindquist، S.، Krobitsch، S.، Li، L. & amp Sondheimer، N. التحقيق في الوراثة القائمة على تكوين البروتين والمرض في الخميرة. فيل. عبر. R. Soc. لوند. ب 356, 169–176 (2001).

Scheibel، T.، Bloom، J. & amp Lindquist، S.L. تتضمن استطالة ألياف بريون الخميرة خطوات منفصلة للارتباط والتحويل. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 101, 2287–2292 (2004).

Ma ، J. ، Wollmann ، R. & amp Lindquist ، S. السمية العصبية والتنكس العصبي عندما يتراكم PrP في العصارة الخلوية. علم 298, 1781–1785 (2002).

Ma، J. & amp Lindquist، S. علم 298, 1785–1788 (2002).

إينس ، إي. & أمبير جلينر ، ج. دراسات حيود الأشعة السينية على خيوط الأميلويد. J. هيستوكيم. سيتوتشيم. 16, 673–677 (1968).

Sunde، M. & amp Blake، C.C. من الحالة الكروية إلى الحالة الليفية: بنية البروتين والتحويل الهيكلي في تكوين الأميلويد. س: القس بيوفيس. 31, 1–39 (1998).

بنزنجر ، T.L. وآخرون. بنية الانتشار لـ Alzheimer-amyloid (10–35) هي ورقة متوازية مع بقايا في السجل الدقيق. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 95, 13407–13412 (1998).

Tycko، R. نظرة ثاقبة على مشكلة طي الأميلويد من الحالة الصلبة NMR. الكيمياء الحيوية 42, 3151–3159 (2003).

Torok، M. et al. السمات الهيكلية والديناميكية لببتيد الزهايمر Aβ في ليفية أميلويد تمت دراستها عن طريق وضع العلامات الدورانية الموجهة للموقع. J. بيول. تشيم. 277, 40810–40815 (2002).

Der-Sarkissian ، A. ، Jao ، CC ، Chen ، J. & amp Langen ، R. التنظيم الهيكلي لألياف α-synuclein المدروسة عن طريق وضع العلامات الدورانية الموجهة للموقع. J. بيول. تشيم. 278, 37530–37535 (2003).

بنزنجر ، T.L. وآخرون. هيكل ثنائي الأبعاد لألياف بيتا أميلويد (10–35). الكيمياء الحيوية 39, 3491–3499 (2000).

بالباخ ​​، ج. وآخرون. تكوين ليف أميلويد بواسطة Aβ16-22 ، جزء من سبع بقايا من ببتيد بيتا أميلويد ألزهايمر ، والتوصيف الهيكلي بواسطة الحالة الصلبة بالرنين المغناطيسي النووي. الكيمياء الحيوية 39, 13748–13759 (2000).

ويليامز ، إيه دي وآخرون. رسم خرائط الهيكل الثانوي لليفات الأميلويد Aβ باستخدام مسح طفرات البرولين. جيه مول. بيول. 335, 833–842 (2004).

ثاكور ، أ. & amp Wetzel، R. التحليل التحولي للتنظيم الهيكلي لمجموعات البولي جلوتامين. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 99, 17014–17019 (2002).

روس ، كاليفورنيا ، بوارير ، ماجستير ، وانكر ، E.E. & amp Amzel ، M. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 100, 1–3 (2003).

Chen، S.، Berthelier، V.، Hamilton، J.B.، O'Nuallain، B. & amp Wetzel، R. الكيمياء الحيوية 41, 7391–7399 (2002).

O'Nuallain، B. & amp Wetzel، R. عبس المطابقة للتعرف على حاتمة ليفية أميلويد عامة. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 99, 1485–1490 (2002).

أوفرسكي ، في. إعادة النظر في طي البروتين. سلسلة بولي ببتيد عند مفترقات الطرق المتقاطعة القابلة للطي وغير القابلة للطي وغير القابلة للطي: أي طريق يجب أن تسلكه؟ خلية مول. علوم الحياة. 60, 1852–1871 (2003).

كلارك ، ج. وآخرون. نموذج واحد لموت الخلايا في التنكسات العصبية الموروثة. طبيعة سجية 406, 195–199 (2000).

دوبسون ، سي. مبادئ طي البروتين واختلاله وتجميعه. سيمين. تطوير الخلية. بيول. 15, 3–16 (2004).

ساكيتيني ، جي سي وأمبير كيلي ، جي دبليو. الاستراتيجيات العلاجية لأمراض الأميلويد البشرية. نات. القس اكتشاف المخدرات. 1, 267–275 (2002).

Lansbury ، PT ، Jr. علم الأعصاب الهيكلية: هل البذور هي أصل التنكس العصبي؟ عصبون 19, 1151–1154 (1997).

سوتو ، سي. الكشف عن دور اختلال البروتين في الأمراض التنكسية العصبية. نات. القس نيوروسسي. 4, 49–60 (2003).

سينجلتون ، أ. وآخرون. يسبب تضاعف موضع α-Synuclein مرض باركنسون. علم 302, 841 (2003).

Singleton، A.، Myers، A. & amp Hardy، J. قانون العمل الجماعي المطبق على أمراض التنكس العصبي: فرضية تتعلق بمسببات الأمراض المعقدة وتسببها. همم. مول. جينيه. 13 (رقم خاص 1) ، R123 – R126 (2004).

كونواي ، K.A. ، Rochet ، JC ، Bieganski ، R.M. & amp Lansbury ، P.T. ، Jr. التثبيت الحركي لـ α-synuclein protofibril بواسطة وصلة dopamine-α-synuclein. علم 294, 1346–1349 (2001).

جياسون ، ب. وآخرون. الضرر التأكسدي المرتبط بالتنكس العصبي عن طريق نترات ألفا سينوكلين الانتقائية في آفات اعتلال النسيج الخلوي. علم 290, 985–989 (2000).

إيواتسوبو ، ت. وآخرون. تنقية وتوصيف أجسام ليوي من أدمغة المرضى الذين يعانون من مرض جسم ليوي المنتشر. أكون. J. باتول. 148, 1517–1529 (1996).

Iwatsubo ، T. تجميع ألفا سينوكلين في التسبب في مرض باركنسون. J. نيورول. 250 (ملحق 3) ، III11 – III14 (2003).

Okochi، M. et al. الفسفرة التأسيسية لمرض باركنسون المرتبط بـ α-synuclein. J. بيول. تشيم. 275, 390–397 (2000).

سبيلانتيني ، إم. وآخرون. α-synuclein في أجسام ليوي. طبيعة سجية 388, 839–840 (1997).

إماميان ، إ. وآخرون. يعتبر Serine 776 من ataxin-1 أمرًا بالغ الأهمية بالنسبة للأمراض التي يسببها البولي جلوتامين في الفئران المعدلة وراثيًا SCA1. عصبون 38, 375–387 (2003).

ستيفان ، ج. وآخرون. تعديل علم أمراض مرض هنتنغتين وهنتنغتون. علم 304, 100–104 (2004).

ديفيجليا ، إم وآخرون. تجمع هنتنغتين في شوائب الخلايا العصبية داخل النواة والعصاب الحثل في الدماغ. علم 277, 1990–1993 (1997).

يعمل Saudou ، F. ، Finkbeiner ، S. ، Devys ، D. & amp Greenberg ، M.E. Huntingtin في النواة للحث على موت الخلايا المبرمج ولكن الموت لا يرتبط بتكوين شوائب داخل النواة. زنزانة 95, 55–66 (1998).

بيترز ، م. وآخرون. يؤدي الاستهداف النووي لطافرة هنتنغتين إلى زيادة السمية. مول. علم الأعصاب الخلوي. 14, 121–128 (1999).

de Almeida، LP، Ross، CA، Zala، D.، Aebischer، P. & amp Deglon، N. توصيل Lentiviral بوساطة هنتنغتين متحولة في مخطط الجرذان يستحث علمًا عصبيًا انتقائيًا تم تعديله بواسطة حجم تكرار متعدد الجلوتامين ، ومستويات تعبير هنتنغتين ، و طول البروتين. J. نيوروسسي. 22, 3473–3483 (2002).

ويلينجتون ، س. وآخرون. انقسام كاسباس في هنتنغتين المتحولة يسبق التنكس العصبي في مرض هنتنغتون. J. نيوروسسي. 22, 7862–7872 (2002).

Gafni، J. et al. يقلل تثبيط انقسام كالبي من هنتنغتين من السمية: تراكم شظايا كالبين / كاسباس في النواة. J. بيول. تشيم. 279, 21211–21220 (2004).

لونكس ، إيه وآخرون. ينتج البروتياز الذي يعمل على هنتنغتين الطافرة منتجات مشقوقة تكوِّن شوائب السيتوبلازم والنووية بشكل مختلف. مول. زنزانة 10, 259–269 (2002).

بوارير ، ماجستير وآخرون. الأجسام الشبه الكروية هنتنغتين واللييفات الأولية كسلائف في الرجفان متعدد الجلوتامين. J. بيول. تشيم. 277, 41032–41037 (2002).

نوسيفورا ، إف سي ، الابن وآخرون. يزيد التوطين النووي لمنتج اقتطاع غير كاسباس من الأتروفين -1 ، مع تكرار متعدد الجلوتامين الموسع ، من السمية الخلوية. J. بيول. تشيم. 278, 13047–13055 (2003).

لي ، إن. وآخرون. تؤثر رباعي سلفونات الفثالوسيانين على تكوين الأميلويد والسمية الخلوية لـ α-synuclein. الكيمياء الحيوية 43, 3704–3715 (2004).

Buxbaum ، J.N. أمراض تكوين البروتين: ماذا تفعل في المختبر تجارب تخبرنا عنها في الجسم الحي الأمراض؟ اتجاهات Biochem. علوم. 28, 585–592 (2003).

Wetzel، R. أفكار الترتيب لهيكل ليفي أميلويد. الهيكل (Camb) 10, 1031–1036 (2002).

Soreghan ، B. ، Kosmoski ، J. & amp Glabe ، C. خصائص الفاعل بالسطح لببتيدات الزهايمر Aβ وآلية تراكم الأميلويد. J. بيول. تشيم. 269, 28551–28554 (1994).

هاربر ، ج.د. ، ليبر ، س. & amp Lansbury ، P. تشيم. بيول. 4, 951–959 (1997).

لامبرت ، م. وآخرون. تعتبر الروابط غير الليفية المنتشرة والمشتقة من Aβ1–42 من السموم العصبية القوية للجهاز العصبي المركزي. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 95, 6448–6453 (1998).

هاربر ، جي دي ، وونغ ، إس إس ، ليبر ، سي إم. & amp Lansbury ، PT ، Jr. في المختبر نموذج لحدث مبكر محتمل في مرض الزهايمر. الكيمياء الحيوية 38, 8972–8980 (1999).

Harper، J.D. & amp Lansbury، PT، Jr. نماذج من بذر الأميلويد في مرض الزهايمر والسكرابي: الحقائق الميكانيكية والعواقب الفسيولوجية للذوبان المعتمد على الوقت لبروتينات الأميلويد. Annu. القس Biochem. 66, 385–407 (1997).

والش ، DM ، Lomakin ، A. ، Benedek ، GB ، Condron ، M.M. & amp Teplow، D.B. تكوين ليفي بروتين أميلويد بيتا. الكشف عن وسيط بروتوفيبيرلار. J. بيول. تشيم. 272, 22364–22372 (1997).

كلاين ، دبليو إل ، كرافت ، ج. & amp Finch، C.E. استهداف قلة قليلة من Aβ: الحل لمعضلة مرض الزهايمر؟ الاتجاهات العصبية. 24, 219–224 (2001).

تيري ، R.D. وآخرون. الأساس المادي للتغييرات المعرفية في مرض الزهايمر: فقدان المشابك هو الارتباط الرئيسي للضعف الإدراكي. آن. نيورول. 30, 572–580 (1991).

ماكلين ، كاليفورنيا. وآخرون. تجمع قابل للذوبان من Aβ أميلويد كمحدد لشدة التنكس العصبي في مرض الزهايمر. آن. نيورول. 46, 860–866 (1999).

لو ، إل إف وآخرون. تركيز الببتيد الأميلويد القابل للذوبان كمؤشر للتغير المشبكي في مرض الزهايمر. أكون. J. باتول. 155, 853–862 (1999).

والش ، د. وآخرون. قلة قليلة إفراز طبيعي لبروتين الأميلويد تمنع بشكل فعال تقوية الحصين على المدى الطويل في الجسم الحي. طبيعة سجية 416, 535–539 (2002).

Volles ، MJ وآخرون. نفاذية الحويصلة عن طريق البروتوفيبيرلار ألفا سينوكلين: الآثار المترتبة على التسبب في مرض باركنسون وعلاجه. الكيمياء الحيوية 40, 7812–7819 (2001).

شارون ، ر. وآخرون. يتم تنظيم تكوين أوليغومرات عالية الذوبان من α-synuclein بواسطة الأحماض الدهنية وتعزز في مرض باركنسون. عصبون 37, 583–595 (2003).

Chen، S.، Berthelier، V.، Yang، W. & amp Wetzel، R. سلوك تجميع البوليجلوتامين في المختبر يدعم آلية توظيف السمية الخلوية. جيه مول. بيول. 311, 173–182 (2001).

Sanchez، I.، Mahlke، C. & amp Yuan، J. الدور المحوري للقلة في الاضطرابات العصبية التنكسية متعددة الجلوتامين. طبيعة سجية 421, 373–379 (2003).

نوسيفورا ، إف سي ، الابن وآخرون. التداخل عن طريق Huntingtin و atrophin-1 مع النسخ بوساطة CBP مما يؤدي إلى سمية خلوية. علم 291, 2423–2428 (2001).

جيانغ ، إتش ، نوسيفورا ، إف سي ، الابن ، روس ، سي. & دي فرانكو ، دي. يرتبط موت الخلايا الناجم عن هنتنغتين الموسع بالبوليجلوتامين في خط الخلية العصبية بتدهور البروتين المرتبط بـ CREB. همم. مول. جينيه. 12, 1–12 (2003).

بينس ، ن.ف. ، سامبات ، ر. & amp Kopito ، R.R. ضعف نظام يوبيكويتين البروتيازوم عن طريق تراكم البروتين. علم 292, 1552–1555 (2001).

كايد ، ر. وآخرون. يشير التركيب الشائع لأوليجومرات الأميلويد القابلة للذوبان إلى آلية مشتركة للإمراض. علم 300, 486–489 (2003).

ماكليلان ، أ. & amp Frydman، J. Molecular chaperones وفن التعرف على قضية خاسرة. نات. خلية بيول. 3، E51 – E53 (2001).

Goldberg، A.L. تحلل البروتين والحماية من البروتينات غير المطوية أو التالفة. طبيعة سجية 426, 895–899 (2003).

Ciechanover، A. & amp Brundin، P. نظام اليوبيكويتين البروتيازومي في الأمراض التنكسية العصبية: أحيانًا الدجاج وأحيانًا البيضة. عصبون 40, 427–446 (2003).

Kopito ، R.R. Aggresomes ، الأجسام المتضمنة وتجميع البروتين. اتجاهات خلية بيول. 10, 524–530 (2000).

Ravikumar ، B. وآخرون. يحث مثبط mTOR على الالتهام الذاتي ويقلل من سمية توسع البوليجلوتامين في نماذج الذباب والفأر لمرض هنتنغتون. نات. جينيه. 36, 585–595 (2004).

تاناكا ، إم وآخرون. Aggresomes المكونة من α-synuclein و synphilin-1 هي مادة واقية للخلايا. J. بيول. تشيم. 279, 4625–4631 (2004).

Verhoef ، L.G. ، Lindsten ، K. ، Masucci ، M.G. & أمبير دانتوما ، ن. يمنع تكوين الركام التحلل البروتيني لبروتينات البولي جلوتامين. همم. مول. جينيه. 11, 2689–2700 (2002).

Winklhofer ، K.F. ، Reintjes ، A. ، Hoener ، MC ، Voellmy ، R. & amp Tatzelt ، J.يستعيد الجلداناميسين استجابة معيبة لصدمة الحرارة في الجسم الحي. J. بيول. تشيم. 276, 45160–45167 (2001).

بايبر ، P.W. كوصي Hsp90 كهدف واعد للمخدرات. بالعملة. رأي. التحقيق. المخدرات 2, 1606–1610 (2001).

ياماموتو ، أ ، لوكاس ، ج. & amp Hen، R. عكس الأمراض العصبية والخلل الوظيفي الحركي في النموذج الشرطي لمرض هنتنغتون. زنزانة 101, 57–66 (2000).

ديفيدسون ، ب. & amp Paulson، H.L. الطب الجزيئي للدماغ: إسكات جينات المرض بتداخل الحمض النووي الريبي. لانسيت نيورول. 3, 145–149 (2004).

ميلر ، في. وآخرون. إسكات جينات المرض السائد الخاصة بأليل. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 100, 7195–7200 (2003).

Monsonego، A. & amp Weiner، H.L. المناهج العلاجية لمرض الزهايمر. علم 302, 834–838 (2003).

ماتسون ، م. & أمبير تشان ، S.L. الأجسام المضادة للأميلويد الجيدة والسيئة. علم 301, 1847–1849 (2003).

Weiner، H.L. & amp Selkoe، D.J. التهابات والتطعيم العلاجي لأمراض الجهاز العصبي المركزي. طبيعة سجية 420, 879–884 (2002).

تاناكا ، إم وآخرون. يخفف تريهالوز من علم الأمراض بوساطة مادة الجلوتامين في نموذج فأر لمرض هنتنغتون. نات. ميد. 10, 148–154 (2004).

Bohrmann، B. et al. يتم إعاقة التجميع الذاتي لـ β-amyloid 42 بواسطة روابط جزيئية صغيرة في مرحلة الوسائط الهيكلية. J. الهيكل. بيول. 130, 232–246 (2000).

Wood، S.J.، MacKenzie، L.، Maleeff، B.، Hurle، M.R. & amp Wetzel، R. تثبيط انتقائي لتشكيل ليفي Aβ. J. بيول. تشيم. 271, 4086–4092 (1996).

Reixach ، N. ، Crooks ، E. ، Ostresh ، J.M. ، Houghten ، R.A. & amp Blondelle، S.E. تثبيط السمية العصبية التي يسببها الأميلويد بواسطة imidazopyridoindoles المشتقة من مكتبة اندماجية اصطناعية. J. الهيكل. بيول. 130, 247–258 (2000).

مايو ، قبل الميلاد وآخرون. تثبيط قوي لتكاثر بريون سكرابي في الخلايا المستزرعة بواسطة أكريدين ثنائي. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 100, 3416–3421 (2003).

Cordeiro ، Y. ، Lima ، LM ، Gomes ، MP ، Foguel ، D. & amp Silva ، JL Modulation of prion protein oligomerization ، التجميع ، وتحويل الصفائح بواسطة 4،4'-dianilino-1،1'-binaphthyl-5 ، 5′-سلفونات (مكرر- ANS). J. بيول. تشيم. 279, 5346–5352 (2004).

هيزر ، ف. وآخرون. تحديد البنزوثيازول كمثبطات محتملة لتراكم البولي جلوتامين لمرض هنتنغتون باستخدام مقايسة تأخر المرشح الآلي. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 99, 16400–16406 (2002).

بوليت ، س. وآخرون. يحدد اختبار FRET الخلوي السريع لتجميع البولي جلوتامين مثبطًا جديدًا. عصبون 40, 685–694 (2003).

John ، V. ، Beck ، J.P. ، Bienkowski ، M.J. ، Sinha ، S. & amp Heinrikson ، R.L. Human β-secretase (BACE) and BACE inhibitors. جيه ميد. تشيم. 46, 4625–4630 (2003).

بيتكوفا ، أ. وآخرون. نموذج هيكلي لألياف بيتا أميلويد لمرض ألزهايمر بناءً على قيود تجريبية من الحالة الصلبة بالرنين المغناطيسي النووي. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية 99, 16742–16747 (2002).


مناقشة

ال فو الجين

في هذه الورقة ، فإن فو تم تحديد الجين وتحديد هيكله. فو يتكون من 29 exons منها exons 1 و 2 يشفران 5'UTRs ، يحتوي exon 3 على كودون ATG البادئ ويحتوي exons 13 و 29 في أكواد توقف الرتل (الشكل 1). قد يعمل Exon 1 و 2 كإكسونات أولى بديلة ، مثل exons البديلة 1 و 1 A و 1 B الموجودة في PTCH1 الجين [23]. تقوم Exons 3 إلى 9 بترميز مجال كيناز. هذا الجزء له تشابه قوي مع ذبابة الفاكهة ، في حين أن الجزء المتبقي من الطرف C لديه تشابه أضعف بكثير [8]. باستخدام برنامج DIALIGN [24] ، من الممكن محاذاة fu إلى L-FU في منطقتين في الجزء C-terminal (غير موضح). يتم ترميزها إلى حد كبير بواسطة exons 15-16 و 22–29. يشير هذا إلى أن exons 10-14 و 17–21 ربما تم تجنيدهم في فو الجين أثناء التطور.

التحقيقات في مواد مريض ارتفاق الأصابع

لقد حققنا في إمكانية ذلك فو يكمن الأساس لـ SD1 بناءً على حقيقة أن فو يقع ضمن فاصل توطين SD1 وهو جزء من مسار إشارات Sonic Hedgehog ، الذي يشارك في الزخرفة الرقمية [1]. على الرغم من تحديد ثلاثة أشكال متعددة الأشكال للنيوكليوتيدات الفردية التي تم الإبلاغ عنها سابقًا ، إلا أننا لم نكتشف أي طفرة في فو منطقة الترميز أو المناطق المرافقة intronic. في حين أن هذه النتائج لا تتورط فو في سبب SD1 ، من الممكن أن يكون هذا الاضطراب ناتجًا عن طفرات في المناطق غير المشفرة التي لم يتم فحصها في هذه الدراسة. بدلاً من ذلك ، يمكن أن يكون سبب SD1 هو إعادة ترتيب الجينوم الذي لم يتم تحديده بواسطة تحليل التسلسل ، على الرغم من عدم اكتشاف أي نطاقات متغيرة في عضو متأثر من عائلة SD1 عن طريق التحليل الجنوبي باستخدام فو استنساخ (كدنا) كمسبار (البيانات غير معروضة).

تحليلات التعبير

تحليلات فو أظهر التعبير أن النصوص يتم اكتشافها في جميع الأنسجة التي تم فحصها. لأول مرة يتم تقديم دليل يوضح أنه يمكن التعبير عن أكثر من نسخة واحدة من هذا الجين. تظهر اللطخات الشمالية بوضوح وجود نسخ FU ذات الأحجام المختلفة بالفعل. هنا يتم تقدير النصوص لتكون أكبر قليلاً مما تم الإبلاغ عنه سابقًا وفي بعض الأنسجة يظهر أكثر من نسخة واحدة. يتضح من تحليلات النسخ المعتمدة على cDNAs و RT / PCR أن التضفير البديل يحدث. بالإضافة إلى ذلك ، من الواضح أيضًا وجود 5'UTRs مختلفة في النصوص. يمكن إنتاج اثنين على الأقل من الأشكال الإسوية للبروتين ، إلى جانب L-FU الموصوف سابقًا [8]. الشكل الإسوي S-FU هو الأكثر اختلافًا بشكل كبير عن L-FU ، ويتألف فقط من الطرف N الذي يمثل ثلث L-FU. ينتج تعبير S-FU عن تضمين exon 13 في النسخة الناضجة. تم اكتشاف حدث التضفير البديل هذا في جميع الأنسجة التي تم فحصها وبنسبة ثابتة ظاهريًا. كما تم الكشف عن حالة تضفير بديل منظم بواسطة RT / PCR ، ولكن مع تأثير أقل بكثير على مستوى البروتين ، حيث أنه يؤدي فقط إلى فقدان 21 من البقايا المشفرة بواسطة exon 24. ومع ذلك ، يكشف التعبير عن نسيج محتمل محدد تنظيم حدث الربط البديل هذا. قد يعكس هذا جيدًا أن L-FUΔ24 يلعب دورًا بيولوجيًا مختلفًا عن L-FU. نظرًا لأنه يبدو أن mRNA لـ L-FUΔ24 لا يتم التعبير عنه في الأمعاء الدقيقة والبروستاتا ، يمكن التكهن بأن FU له دور مختلف هناك ، إذا فُقد سحاب leucine حقًا في L-FUΔ24. من المثير للاهتمام أن الخصية تبدو وكأنها تعبر عن نصوص مع وبدون مقطع 63 زوجًا أساسًا وهي أيضًا الأنسجة ذات التعبير الأقوى. ربما يرتبط تعبير L-FUΔ24 و L-FU معًا بوظيفة قنفذ الصحراء الذي ثبت أنه يلعب دورًا خاصًا في تكوين الحيوانات المنوية [25]. سواء تم تغيير التفاعلات مع بروتينات GLI أو SUFU أو المكونات الأخرى لمسار الإشارة ، وإذا كان لهذا أي تأثير على أنشطة GLI أو SUFU ، فلا يزال يتعين التحقيق فيه. من المؤكد أن هذا يضيف متغيرًا آخر إلى الصورة المعقدة لإشارات القنفذ وتنظيم GLI في الفقاريات.

التحقيقات الوظيفية ووجهات النظر

كشف تقييم الوظيفة أن S-FU لم يكن قادرًا على تنظيم GLI1 أو GLI2 عند التعبير عنه في 293 خلية. في المقابل ، كان كل من L-FU والمتغير الذي يفتقر إلى مجال كيناز كامل (2HFU) قادرين على تعزيز النسخ المستحث بـ GLI2. هذه النتائج تشبه نوعيا تلك التي تم الإبلاغ عنها سابقًا في خلايا C3H / 10T½ [8]. كان L-FU و 2 HFU قادرين فقط على تعزيز نشاط GLI2 من 2 إلى 3 أضعاف في 293 خلية ، بينما شوهدت تحريضات من 5 إلى 8 أضعاف في خلايا C3H / 10T½. قد يعكس هذا حقيقة أن خط الخلية الأخير يعبر عن مكونات إضافية لمسار إشارات Hedgehog ، والتي تعد مطلوبة للنشاط الكامل لـ FU. على عكس التحقيقات السابقة [8] لم يكن من الممكن رؤية تأثير L-FU على SUFU. مرة أخرى ، يمكن تفسير هذا الاختلاف من خلال الخصائص المختلفة لخطوط الخلايا المستخدمة. قد يكشف فهم أحداث الإشارات في اتجاه مجرى SMO عن اختلافات وظيفية في البروتينات المعنية ، مقارنة بنظيراتها من ذبابة الفاكهة. على الرغم من أن SUFU يثبط عوامل نسخ GLI و su (fu) يثبط Ci ، فلا تزال هناك اختلافات مذهلة. حتى الآن لم تكن هناك تقارير عن نظير cos2 في الفقاريات. وبدلاً من ذلك ، لوحظ أن FU يتفاعل مع جميع بروتينات GLI و SUFU [8] ، على الرغم من أن fu لا يرتبط بـ Ci [26]. وقد لوحظ أيضًا أنه يمكن العثور على كل من L-FU و SUFU في النواة [5-8] ، والتي لم يتم ملاحظتها بالنسبة لـ fu أو su (fu). من المحتمل أن يتم نقل كل من FU و SUFU داخل وخارج النواة عن طريق الارتباط ببروتينات GLI [5 ، 8]. على الرغم من الحفاظ على الأنشطة الأساسية لكل من FU و SUFU في تنظيم GLI ، إلا أنه يبدو أيضًا وجود اختلافات كبيرة عن نظرائهم من ذبابة الفاكهة. من الواضح أن FU ليس لها تأثير على GLI1 مشابه لما شوهد في GLI2. هناك حاجة إلى مزيد من التحقيقات من أجل تحديد دور FU في إشارات القنفذ والتحكم في GLI. لا يزال دور الأشكال الإسوية المختلفة بحاجة إلى توضيح. يجب اختبارها بشكل فردي لتنظيمها لجميع بروتينات GLI والمنتجات المحللة للبروتين. من المعروف أن فو له وظيفتان فسيولوجيتان منفصلتان على الأقل في الذبابة ، إحداهما تعتمد على مجال كينيز [27]. وبالمثل ، قد يكون لل FU وظيفتان مميزتان أو أكثر في الإشارة ، ممثلة بمجالات مختلفة ، وأشكال إسوية وتفاعلات بروتينية.


نتائج

طفرات المريض في KDM5C

حصلنا على أرومات ليفية من سبعة مرضى يعانون من XLID الناجم عن أربع طفرات مستقلة في KDM5C (الجدول 1). يظهر في الشكل 1 أ موقع الطفرات فيما يتعلق بالسمات المشروحة لبروتين KDM5C. تم الإبلاغ سابقًا عن الطفرات والأعراض السريرية لـ p.D402Y (12) ، p.P480L (22) و c.2T & gtC (23). أظهر المريض المصاب بطفرة c.3223delG (p.V1075Yfs * 2) معرف حاد مع تأخر في النمو وقصر القامة (النسبة المئوية الخامسة إلى العاشرة) وفرط المنعكسات. مشى المريض 3223delG-1 في عمر 22 شهرًا ، واستخدم 6-8 كلمات فقط في سن 13.5 عامًا ، وكان يعاني من الحول ، والحنك الضيق المرتفع والإمساك. قمنا أيضًا بفحص الأرومات الليفية من أنثى حاملة غير متجانسة للطفرة 3223delG (3223delG-HET والدة الذكر المصاب) ، والتي تطلبت دروسًا في المدرسة ولديها حنك ضيق مرتفع. إن أخت المريض (التي لم يتم التحقيق فيها) هي أيضًا حاملة للطفرة وتظهر إعاقة ذهنية خفيفة وتأخرًا في النمو وفرط المنعكسات وحنكًا ضيقًا مرتفعًا ، مما يشير إلى أن الطفرة يمكن أن تكون ضارة في بيئة متغايرة الزيجوت. بالنسبة لعناصر التحكم ، حصلنا على الخلايا الليفية للقلفة BJ من الدكتور جورج كيو دالي (مستشفى بوسطن للأطفال) وقمنا بالتحكم في الخلايا الليفية الجلدية للذكور من مستودع خلايا Coriell (Control-1: GM03348 ، 10 سنوات Control-2: AG06234 ، 17 عامًا).

معلومات الخلايا الليفية للمريض

. معرف المريض. أسرة . العمر عند الخزعة (سنة). طفرة كدنا. طفرة البروتين. هوية شخصية . ملاحظات سريرية.
D402Y-1 38505 A034 72 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، العدوان
D402Y-2 38506 A034 67 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، نوبات نادرة ، عدوانية
P480L-1 13185 K9330 8 ج 1439 ج و GTT ص 480L معتدل DD ، الحول ، الجنف الخفيف
P480L-2 13186 K9330 1 ج 1439 ج و GTT ص 480L خفيف DD ، قصر القامة ، رعاش ، نوبات ، عدوانية
2T & gtC-1 13008 23 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، الحول ، النوبات ، الرنح ، العدوانية
2T & gtC-2 13009 13 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، ترنح ،
3223delG-1 22986 K9607 17 ج 3223delG ص. V1075Yfs * 2 شديدة DD ، قصر القامة ، الحول ، فرط المنعكسات ،
. معرف المريض. أسرة . العمر عند الخزعة (سنة). طفرة كدنا. طفرة البروتين. هوية شخصية . ملاحظات سريرية.
D402Y-1 38505 A034 72 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، العدوان
D402Y-2 38506 A034 67 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، نوبات نادرة ، عدوانية
P480L-1 13185 K9330 8 ج 1439 ج و GTT ص 480L معتدل DD ، الحول ، الجنف الخفيف
P480L-2 13186 K9330 1 ج 1439 ج و GTT ص 480L خفيف DD ، قصر القامة ، رعاش ، نوبات ، عدوانية
2T & gtC-1 13008 23 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، الحول ، النوبات ، الرنح ، العدوانية
2T & gtC-2 13009 13 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، ترنح ،
3223delG-1 22986 K9607 17 ج 3223delG ص. V1075Yfs * 2 شديدة DD ، قصر القامة ، الحول ، فرط المنعكسات ،

التعليقات التوضيحية المستندة إلى متغير نسخة 1 (uc004drz.3 / NM_004187) الخاص بـ Homo sapiens lysine (K) - ديميثيلاز 5C (KDM5C) المحدد في مجموعة الجينوم GRCh38 / hg38.

الهوية ، الإعاقة الذهنية DD ، تأخر النمو.

معلومات الخلايا الليفية للمريض

. معرف المريض. أسرة . العمر عند الخزعة (سنة). طفرة كدنا. طفرة البروتين. هوية شخصية . ملاحظات سريرية.
D402Y-1 38505 A034 72 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، العدوان
D402Y-2 38506 A034 67 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، نوبات نادرة ، عدوانية
P480L-1 13185 K9330 8 ج 1439 ج و GTT ص 480L معتدل DD ، الحول ، الجنف الخفيف
P480L-2 13186 K9330 1 ج 1439 ج و GTT ص 480L خفيف DD ، قصر القامة ، رعاش ، نوبات ، عدوانية
2T & gtC-1 13008 23 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، الحول ، النوبات ، الرنح ، العدوانية
2T & gtC-2 13009 13 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، ترنح ،
3223delG-1 22986 K9607 17 ج 3223delG ص. V1075Yfs * 2 شديدة DD ، قصر القامة ، الحول ، فرط المنعكسات ،
. معرف المريض. أسرة . العمر عند الخزعة (سنة). طفرة كدنا. طفرة البروتين. هوية شخصية . ملاحظات سريرية.
D402Y-1 38505 A034 72 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، العدوان
D402Y-2 38506 A034 67 حوالي 1204G و GTT ص متوسطة الى شديدة DD ، قصر القامة ، نوبات نادرة ، عدوانية
P480L-1 13185 K9330 8 ج 1439 ج و GTT ص 480L معتدل DD ، الحول ، الجنف الخفيف
P480L-2 13186 K9330 1 ج 1439 ج و GTT ص 480L خفيف DD ، قصر القامة ، رعاش ، نوبات ، عدوانية
2T & gtC-1 13008 23 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، الحول ، النوبات ، الرنح ، العدوانية
2T & gtC-2 13009 13 ج 2T و GTC ص M1_E165del شديدة DD ، قصر القامة ، ترنح ،
3223delG-1 22986 K9607 17 ج 3223delG ص. V1075Yfs * 2 شديدة DD ، قصر القامة ، الحول ، فرط المنعكسات ،

التعليقات التوضيحية المستندة إلى متغير نسخة 1 (uc004drz.3 / NM_004187) الخاص بـ Homo sapiens lysine (K) - ديميثيلاز 5C (KDM5C) المحدد في مجموعة الجينوم GRCh38 / hg38.

الهوية ، الإعاقة الذهنية DD ، تأخر النمو.

تحول طفرة c.3223delG دون تعبير KDM5C ، لكن طفرات المريض الأخرى متوافقة مع إنتاج النسخ والبروتين. (أ) رسم تخطيطي لبنية بروتين KDM5C ، مع تحديد المجالات وطفرات المريض. M166 هو كودون البدء المتوقع للمرضى الذين يعانون من طفرة c.2T و gtC. يتم رفع الجسم المضاد KDM5C مقابل الأحماض الأمينية C-terminal 100 للبروتين. (ب) تحليل KDM5C تضخيم الحمض النووي الريبي باستخدام إما بادئات عشوائية (قضبان مملوءة) أو بادئات oligo dT (قضبان مفتوحة) يوضح ذلك KDM5C تم اكتشاف الحمض النووي الريبي في الذكور المصابين الذين يظهرون طفرات p.D402Y ، p.P480L أو c.2T & gtC ، ولكن ليس في الذكر المصاب بطفرة c.3223delG. يتم عرض المتوسط ​​والانحراف المعياري لـ 3-4 تجارب مستقلة (*ص & lt 0.01 مقارنة بـ Control-1 ، للطالب ر-اختبار). تم اكتشاف الحمض النووي الريبي باستخدام بادئات تمتد على تقاطعات exon-exon ، وتم تطبيعها مع جين التدبير المنزلي RSP18 ثم Control-1 الخلايا الليفية. (ج) تظهر محللة الخلية الكاملة من الخلايا الليفية الجلدية للمريض تعبير بروتين KDM5C في الذكور المصابين الذين يظهرون طفرات p.P480L و p.D402Y. لم يتم الكشف عن أي تعبير في الذكر المصاب c.3223delG. ينتج الذكور الذين يحملون طفرة c.2T و gtC منتج KDM5C مبتورًا. النطاق الأدنى ، x ، غير محدد. أنبوب ، التحكم في التحميل. (د) KDM5C shRNAs تقلل KDM5C نسخة في السيطرة- BJ و c.2T و gtC الخلايا الليفية. يتم عرض المتوسط ​​والانحراف المعياري لتجربتين مستقلتين (*ص & lt 0.05 مقارنة بـ FF ، للطالب ر-اختبار). تم اكتشاف الحمض النووي الريبي باستخدام بادئات تمتد على تقاطعات exon-exon ، وتم تطبيعها مع جين التدبير المنزلي RSP18 ثم السيطرة على عينات shRNA (FF ، يراعة لوسيفيراز). (ه) تظهر اللطخات الغربية أن المنتج المقطوع المنتج في الخلايا الليفية c.2T و gtC يتم تقليله عند علاج KDM5C-shRNA ، مما يشير إلى أنه محدد. النطاق الأدنى ، x ، غير محدد. ACTIN ، التحكم في التحميل.

تحول طفرة c.3223delG دون تعبير KDM5C ، لكن طفرات المريض الأخرى متوافقة مع إنتاج النسخ والبروتين. (أ) رسم تخطيطي لبنية بروتين KDM5C ، مع تحديد المجالات وطفرات المريض. M166 هو كودون البدء المتوقع للمرضى الذين يعانون من طفرة c.2T و gtC. يتم رفع الجسم المضاد KDM5C مقابل الأحماض الأمينية C-terminal 100 للبروتين. (ب) تحليل KDM5C تضخيم الحمض النووي الريبي باستخدام إما بادئات عشوائية (قضبان مملوءة) أو بادئات oligo dT (قضبان مفتوحة) يوضح ذلك KDM5C تم اكتشاف الحمض النووي الريبي في الذكور المصابين الذين يظهرون طفرات p.D402Y ، p.P480L أو c.2T & gtC ، ولكن ليس في الذكر المصاب بطفرة c.3223delG. يتم عرض المتوسط ​​والانحراف المعياري لـ 3-4 تجارب مستقلة (*ص & lt 0.01 مقارنة بـ Control-1 ، للطالب ر-اختبار). تم اكتشاف الحمض النووي الريبي باستخدام بادئات تمتد على تقاطعات exon-exon ، وتم تطبيعها مع جين التدبير المنزلي RSP18 ثم Control-1 الخلايا الليفية. (ج) تظهر محللة الخلية الكاملة من الخلايا الليفية الجلدية للمريض تعبير بروتين KDM5C في الذكور المصابين الذين يظهرون طفرات p.P480L و p.D402Y. لم يتم الكشف عن أي تعبير في الذكر المصاب c.3223delG. ينتج الذكور الذين يحملون طفرة c.2T و gtC منتج KDM5C مبتورًا. النطاق الأدنى ، x ، غير محدد. أنبوب ، التحكم في التحميل. (د) KDM5C shRNAs تقلل KDM5C نسخة في السيطرة- BJ و c.2T و gtC الخلايا الليفية. يتم عرض المتوسط ​​والانحراف المعياري لتجربتين مستقلتين (*ص & lt 0.05 مقارنة بـ FF ، للطالب ر-اختبار). تم اكتشاف الحمض النووي الريبي باستخدام بادئات تمتد على تقاطعات exon-exon ، وتم تطبيعها مع جين التدبير المنزلي RSP18 ثم السيطرة على عينات shRNA (FF ، يراعة لوسيفيراز). (ه) تظهر اللطخات الغربية أن المنتج المقطوع المنتج في الخلايا الليفية c.2T و gtC يتم تقليله عند علاج KDM5C-shRNA ، مما يشير إلى أنه محدد. النطاق الأدنى ، x ، غير محدد. ACTIN ، التحكم في التحميل.

تقلل طفرات المريض من مستويات البروتين KDM5C

قمنا أولاً بتحليل تأثير الطفرات الجينية على مستوى تعبير RNA لـ KDM5C في الخلايا الليفية للمريض والتحكم باستخدام qRT-PCR (النسخ العكسي الكمي باستخدام PCR الشكل 1 ب). قمنا بتحليل كل من إجمالي الحمض النووي الريبي الذي تم تضخيمه باستخدام السداسيات العشوائية (القضبان المملوءة) ومضخم الرنا المرسال متعدد الأدينيلات باستخدام بادئات oligo dT (القضبان المفتوحة). الخلايا الليفية للمريض تؤوي p.D402Y ، p.P480L و c.2T & gtC الطفرات المعبر عنها KDM5C. ومع ذلك ، كانت هناك انخفاضات كبيرة في مستويات الكل وعديد الأدينيلات KDM5C الحمض النووي الريبي في الخلايا الليفية مع طفرة p.P480L ، وبشكل إجمالي KDM5C الحمض النووي الريبي في الخلايا الليفية مع طفرة p.D402Y. KDM5C تم تخفيض مستويات الرنا المرسال في الخلايا الليفية c.3223delG بشكل كبير إلى -15٪ من خطوط خلايا التحكم ، بما يتوافق مع استهداف mRNA الناتج عن تحلل الرنا المرسال غير المعقول (الشكل 1 ب). KDM5C انخفضت مستويات الرنا المرسال في الأنثى الحاملة c.3223delG بشكل طفيف ولكن بشكل ملحوظ مقارنةً بخلايا الأرومات الليفية في الجلد.

KDM5C هو عضو في عائلة KDM5 demethylase وقد تعوض متماثلات KDM5C عن فقدان KDM5C للوظيفة. لذلك قمنا بتحليل مستوى تعبير mRNA لأفراد عائلة KDM5 KDM5A, KDM5B و KDM5D (المعروف أيضًا باسم RBP2, PLU-1 و SMCY، على التوالي) ، لمعرفة ما إذا تم تغييرها في الخلايا الليفية للمريض KDM5C الطفرات (المواد التكميلية ، الشكل S1 أ). مستويات KDM5A كانت mRNA قابلة للمقارنة في جميع خطوط الخلايا الليفية للمريض والسيطرة. مستويات KDM5B تم تقليل الحمض النووي الريبي بشكل طفيف ولكن بشكل ملحوظ في P480L-2 و 2T و gtC-1 و 3223delG-1 و 3223delG-HET. مرتبط بـ Y SMCY لم يكن من الممكن اكتشافه في الأنثى الحاملة كما هو متوقع ، ولكنه موجود بمستويات مماثلة في الذكور المصابين والضوابط.

c.1204G & gtT و c.1439C & gtT هي طفرات خطأ يُتوقع أن تؤدي إلى بروتين KDM5C كامل الطول مع استبدال الأحماض الأمينية في بقايا واحدة: p.D402Y و p.P480L ، على التوالي. كما هو متوقع ، اكتشفنا بروتين KDM5C بالوزن الجزيئي المتوقع (176 كيلو دالتون) على البقع الغربية لمحلول الخلية الكاملة من الخلايا الليفية ذات الطفرات c.1204G & gtT و c.1439C & gtT (الشكل 1C) باستخدام جسم مضاد مرفوع ضد الطرف C لـ KDM5C (الشكل 1 أ). على النقيض من ذلك ، يُتوقع أن يتسبب c.3223delG في حدوث طفرة في الإطارات تقدم كودون إنهاء سابق لأوانه (PTC) في الموضع فورًا بعد أول حمض أميني تم تغييره (p.V1075Yfs * 2). هذا يتفق مع المستويات المنخفضة من KDM5C تم الكشف عن الحمض النووي الريبي في 3223delG-1 الخلايا الليفية (الشكل 1 ب) ولم نتوقع أي إنتاج للبروتين. لم نكتشف بروتين KDM5C في الخلايا الليفية c.3223delG (الشكل 1C) ، ولكن الجسم المضاد KDM5C يتم رفعه إلى جزء من KDM5C خارج PTC (الشكل 1 أ) وبالتالي لن يكتشف منتجًا محتملاً. ومن المثير للاهتمام ، أننا اكتشفنا بروتين KDM5C في الخلايا الليفية مع طفرة c.2T و gtC في كودون بدء الترجمة الخاص بـ KDM5C (الشكل 1 ج). يعمل بروتين c.2T و gtC KDM5C بوزن جزيئي أقل من النوع البري KDM5C ، مما يشير إلى إنتاج بروتين مبتور طرفيًا داخل الإطار. الأهم من ذلك ، أن المستويات العالمية من بروتين KDM5C أقل في جميع خطوط المرضى مقارنةً بالضوابط (الشكل 1C).

للتحقق من أن نطاق الوزن الجزيئي السفلي الذي شوهد في لطخات غربية KDM5C من الخلايا الليفية c.2T و gtC هي نسخة بديلة من KDM5C ، عالجنا التحكم والأرومات الليفية c.2T و gtC باستهداف shRNAs KDM5C. أكد تحليل qRT-PCR أن اثنين KDM5C خفضت shRNAs مستويات KDM5C النسخ الموجودة في خلايا المريض الضابطة و c.2T و gtC مقارنة بعينات shRNA غير المصابة والسيطرة المصابة (FF ، اليراع luciferase) (الشكل 1 د). أظهر تحليل لطخة ويسترن ذلك KDM5C تقلل تركيبات shRNA من إشارة KDM5C كاملة الطول في الخلايا الليفية الضابطة ، وتقلل أيضًا إشارة الوزن الجزيئي المنخفضة في الخلايا الليفية c.2T و gtC (الشكل 1E) مما يؤكد أن البروتين الذي تم التعرف عليه بواسطة الجسم المضاد KDM5C في هذه الخلايا المريض هو بالفعل مبتور KDM5C.

مرضى C.2T و gtC يعبرون عن بروتين p.M1_E165del KDM5C المقطوع نهائيًا

تتوقع خوارزميات التنبؤ بموقع بدء الترجمة استنادًا إلى تسلسل الحمض النووي أنه عند وجود طفرة c.2T و gtC ، تبدأ ترجمة KDM5C عند الميثيونين (M) في الموضع 166 ، مما يشير إلى أن البروتين المقطوع هو p.M1_E165del. M166 في إطار مع كودون البدء الكنسي ، تمشيا مع التعرف على الشكل المقطوع بواسطة جسم مضاد مرفوع مقابل الطرف C لـ KDM5C (الشكل 1 أ). ص. المجالات (الشكل 1 أ).

لاختبار الفرضية القائلة بأن خلايا المريض c.2T و gtC تنتج p.M1_E165del KDM5C ، أنشأنا تركيبات تعبير KDM5C الموسومة بعلامات C ترميز إما تسلسل الترميز كامل الطول مع طفرة c.2T و gtC ، أو تسلسل ترميز مبتور يبدأ برمز M166 (ج A1_A495del). الإفراط في التعبير عن هذه التركيبات في الخلايا الليفية التي تفتقر إلى KDM5C الذاتية (حوالي 3223delG الخلايا الليفية للمريض ، الشكل 2 أ) أو في الخلايا الليفية للتحكم BJ (المواد التكميلية ، الشكل S1 B) متبوعة بالبقع الغربية أظهرت أن البروتينات المشفرة بواسطة c.2T و gtC و c.A1_A495del KDM5C تعمل بوزن جزيئي مماثل ، مما يدعم فرضيتنا. كانت البيانات المستمدة من الإفراط في التعبير عن KDM5C الموسوم بـ N مع طفرات المريض الأخرى متوافقة مع نتائج خلايا المريض: الطفرات الخاطئة p.P480L و p.D402Y تنتج بروتين كامل الطول (الشكل 2 أ ، المواد التكميلية ، الشكل S1 ب).

p.M1_E165del يتم إنتاج KDM5C في الخلايا الليفية للمريض c.2T & gtC. (أيوضح التعبير المفرط لـ KDM5C-Flag-HA في الخلايا الليفية التي تفتقر إلى KDM5C الداخلي حجمًا مشابهًا للبروتينات من ناقل تعبير c.2T و gtC KDM5C ، وواحد يبدأ عند p.M166. يؤكد الإفراط في التعبير عن HA-Flag-KDM5C الذي يؤوي طفرات المريض أن p.P480L و p.D402Y هما طفرات مغلوطة. H514A هو طفرة حفزية خالية (13). ACTIN ، التحكم في التحميل. (بيوضح التعبير الزائد عن KDM5C غير الموسوم أن KDM5C بدءًا من M166 هو وزن جزيئي مماثل لـ KDM5C الداخلي في الخلايا الليفية للمريض c.2T و gtC. النطاق الأدنى ، x ، غير محدد.

p.M1_E165del يتم إنتاج KDM5C في الخلايا الليفية للمريض c.2T & gtC. (أيوضح الإفراط في التعبير عن KDM5C-Flag-HA في الخلايا الليفية التي تفتقر إلى KDM5C الداخلي حجمًا مشابهًا للبروتينات من متجه تعبير KDM5C c.2T و gtC ، وواحد يبدأ في p.M166. يؤكد الإفراط في التعبير عن HA-Flag-KDM5C الذي يؤوي طفرات المريض أن p.P480L و p.D402Y هما طفرات مغلوطة. H514A هو طفرة حفزية خالية (13). ACTIN ، التحكم في التحميل. (بيوضح التعبير الزائد عن KDM5C غير الموسوم أن KDM5C بدءًا من M166 هو وزن جزيئي مماثل لـ KDM5C الداخلي في الخلايا الليفية للمريض c.2T و gtC. النطاق الأدنى ، x ، غير محدد.

ثم قمنا بإفراط في التعبير عن النوع البري أو c.A1_A495del KDM5C بدون علامات في KDM5C- الخلايا الليفية الخالية ومقارنة الوزن الجزيئي للبروتين الناتج مع بروتين KDM5C الداخلي من السيطرة أو الخلايا الليفية للمريض c.2T و gtC (الشكل 2 ب). لاحظنا أن KDM5C من النوع البري المفرط يعمل بوزن جزيئي مماثل لـ KDM5C في الخلايا الليفية للتحكم ، كما هو متوقع. ينتج عن الإفراط في التعبير c.A1_A495del بروتين KDM5C الذي يعمل بوزن جزيئي مماثل لـ KDM5C الذاتية في الخلايا الليفية c.2T و gtC ، مما يشير إلى أن p.M1_E165del يتم إنتاجه في هؤلاء المرضى.

يرتبط P.M1_E165del KDM5C بالكروماتين

قمنا أولاً بتقييم ما إذا كان غياب مجال ربط الحمض النووي ARID (24) يمنع p.M1_E165del KDM5C من الارتباط بالكروماتين. لاختبار هذا ، بالغنا في التعبير KDM5C مع طفرات المريض أو KDM5C تفتقر إما إلى مجال JmjN أو مجال ARID ، والخلايا المجزأة إلى السيتوبلازم والنيوكليوبلازم والكروماتين ، قبل النشاف الغربي لـ KDM5C (الشكل 3). لا يؤدي فقدان نطاق JmjN ولا مجال ARID إلى منع اكتشاف KDM5C في جزء الكروماتين. تم العثور على اقتطاع p.M1_E165del KDM5C أيضًا في جزء الكروماتين (الشكل 3). أكد تجزئة خطوط خلايا المريض c.2T و gtC الارتباط الداخلي مع الكروماتين (المواد التكميلية ، الشكل S2).

يمكن ربط KDM5C المقطوع c.2T و gtC مع الكروماتين. تجزئة KDM5C- الخلايا الليفية الخالية من التعبير الزائد عن KDM5C-Flag-HA يوضح أن KDM5C لا يتطلب مجالات JmjN أو ARID لربط الكروماتين. عناصر التحكم في تحميل TUBULIN (السيتوبلازم) و P300 (النيوكليوبلازم) و H3 (الكروماتين). اللوحة اليمنى ، ضوابط التجزئة.

يمكن ربط KDM5C المقطوع c.2T و gtC مع الكروماتين. تجزئة KDM5C- الخلايا الليفية الخالية من التعبير الزائد عن KDM5C-Flag-HA يوضح أن KDM5C لا يتطلب مجالات JmjN أو ARID لربط الكروماتين. عناصر التحكم في تحميل TUBULIN (السيتوبلازم) و P300 (النيوكليوبلازم) و H3 (الكروماتين). اللوحة اليمنى ، ضوابط التجزئة.

طفرات المريض في KDM5C تقليل استقرار البروتين

تنخفض المستويات العالمية من بروتين KDM5C في الخلايا الليفية للمريض مقابل مجموعة الضوابط (الشكل 1C) ، في حين أن مستويات الحمض النووي الريبي قابلة للمقارنة (الشكل 1 ب) ، مما يشير إلى أن طفرات المريض يمكن أن تؤثر على استقرار KDM5C. لاختبار هذه الفرضية بشكل مباشر ، أجرينا تحليلات الدورة الزمنية باستخدام مثبط الترجمة سيكلوهيكسيميد في مجموعة التحكم والخلايا الليفية للمريض (الشكل 4). بروتين KDM5C مستقر نسبيًا في الخلايا الليفية الخاضعة للتحكم ، مع عمر نصف لا يقل عن 12 ساعة. تتمتع الخلايا الليفية ذات الطفرة الخاطئة p.D402Y بعمر نصف KDM5C يبلغ 4 ساعات ، بينما تُظهر p.P480L KDM5C انخفاضًا أكثر دراماتيكية إلى حوالي ساعتين. تُظهر الخلايا الليفية ذات الطفرة c.2T و gtC أيضًا انخفاضًا حادًا في استقرار البروتين ، مع عمر نصف يبلغ 2 ساعة (الشكل 4).

طفرات المريض تزعزع استقرار KDM5C. تدل الدورات الزمنية Cycloheximide (CHX ، 100 ميكروغرام / مل) على التحكم والخلايا الليفية للمريض على أن KDM5C في الخلايا الليفية للمريض مع طفرات c.2T و gtC و p480L و p.D402Y أقل استقرارًا من KDM5C في الخلايا الليفية المتحكمة. أنبوب ، ضوابط التحميل.

طفرات المريض تزعزع استقرار KDM5C. تدل الدورات الزمنية Cycloheximide (CHX ، 100 ميكروغرام / مل) على التحكم والخلايا الليفية للمريض على أن KDM5C في الخلايا الليفية للمريض مع طفرات c.2T و gtC و p480L و p.D402Y أقل استقرارًا من KDM5C في الخلايا الليفية الضابطة. أنبوب ، ضوابط التحميل.

وبالمثل ، فإن الدورات الزمنية cycloheximide على KDM5C- الخلايا الليفية الخالية من الإفراط في التعبير KDM5C مع طفرات مختلفة تظهر أن البروتينات المشفرة c.2T & gtC و c.A1_A495del لها فترات نصف عمر أقصر بكثير من KDM5C من النوع البري (المواد التكميلية ، الشكل S3). ومن المثير للاهتمام ، أنه لوحظ أيضًا انخفاض في الاستقرار بالنسبة لـ KDM5C الذي يفتقر إلى مجال JmjN ، ولكن ليس لـ KDM5C الذي يفتقر إلى مجال ARID ، مما يشير إلى أن عدم وجود مجال JmjN هو الذي يقلل من استقرار c.2T و gtC المريض KDM5C (المواد التكميلية ، الشكل . S3). هذا يتماشى مع مجال JmjN كونه مهمًا للاستقرار في ديميثيلاسز أخرى تحتوي على JmjC (25 ، 26).

تقلل طفرات المريض في KDM5C من نشاط هيستون ديميثيلاز

لقد ثبت أن بعض الطفرات الخاطئة للمريض ، بما في ذلك p.D402Y ، تعرض نشاط KDM5C demethylase للخطر (13 ، 14 ، 17) ، ولكن لم يتم التحقيق في تأثير طفرة p.P480L. علاوة على ذلك ، يحتوي p.M1_E165del KDM5C المقتطع في مرضى c.2T و gtC على المجال الحفزي لـ JmjC ولكنه يفتقد إلى المجالات الأخرى المحفوظة بشكل كبير ، ونشاط demethylase غير معروف.

لذلك سألنا عما إذا كانت طفرات المريض قد أدت إلى انخفاض نشاط نزيل ميثيلاز KDM5C في المختبر. قمنا بتنقية KDM5C و KDM5C من النوع البري الذي يحتوي إما على طفرة محفزة خالية [p.H514A] (13) أو طفرات مريض (p.D402Y ، p.P480L ، p.M1_E165del) من خلايا حشرية (الشكل 5 أ). استخدمنا هذه البروتينات المنقاة في مقايسات demethylase على ببتيدات هيستون (الشكل 5 ب) أو على الهيستونات المنقاة (الشكل 5 ج) ، وقمنا بتقييم النتائج باستخدام إما مطياف الكتلة أو لطخة غربية باستخدام الأجسام المضادة لتعديل الهيستون ، على التوالي. وتجدر الإشارة إلى أنه لم يكن من الممكن التعبير عن p.M1_E165del وتنقيته إلى نفس مستوى التركيبات الأخرى (الشكل 5 أ) ، ويرجع ذلك على الأرجح إلى عدم الاستقرار المتأصل في هذا البروتين ، وهذا تحذير في تقييم نشاط demethylase الخاص به .

تقلل طفرات إعادة بدء الترجمة والخطأ من نشاط demethylase لـ KDM5C في المختبر. (أ) لطخات Coomassie و KDM5C من KDM5C المنقى من خلايا الحشرات Sf9 واستخدامها في فحوصات demethylase على الببتيدات (ب) أو هيستون (ج). KDM5C من النوع البري demethylates H3K4me3 و H3K4me2 لا يحتوي النموذج الخالي الحفاز H514A على أي نشاط. p.D402Y ، p.P480L و p.M1_E165del الطفرات تقلل نشاط KDM5C demethylase.

تقلل طفرات إعادة بدء الترجمة والخطأ من نشاط demethylase لـ KDM5C في المختبر. (أ) لطخات Coomassie و KDM5C من KDM5C المنقى من خلايا الحشرات Sf9 واستخدامها في فحوصات demethylase على الببتيدات (ب) أو هيستون (ج). KDM5C من النوع البري demethylates H3K4me3 و H3K4me2 لا يحتوي النموذج الخالي الحفاز H514A على أي نشاط. p.D402Y ، p.P480L و p.M1_E165del الطفرات تقلل نشاط KDM5C demethylase.

يقوم KDM5C من النوع البري بإزالة ميثيلات H3K4me2 الببتيدات إلى H3K4me1 و H3K4me3 إلى H3K4me2 (الشكل 5 ب) ، كما رأينا سابقًا (13 ، 14). لا يُظهر بروتين p.H514A الأنزيمي الميت أي نشاط يمكن اكتشافه في مادة demethylase على ببتيدات H3K4me2 أو H3K4me3. تقلل طفرات المريض p.P480L و p.D402Y بشدة من نشاط demethylase على كل من الببتيدات H3K4me2 و H3K4me3 مقارنةً بالنوع البري KDM5C ، على الرغم من أنها تظهر نشاطًا متبقيًا مقارنةً بالطفرة المحفزة الخالية (الشكل 5 ب).

بالإضافة إلى فحوصات demethylase باستخدام ببتيدات هيستون ، قمنا باختبار ما إذا كانت طفرات KDM5C للمريض تغير نشاط demethylase على الهيستونات المنقاة ، والتي تعد ركائز ذات صلة من الناحية الفسيولوجية. يقوم KDM5C من النوع البري بإزالة الميثيلات H3K4me2 و H3K4me3 على الهستونات المنقاة كما تم الإبلاغ عنه سابقًا ، ولكنه لا ينتج عنه تغييرات جوهرية في مستوى H3K4me1 أو H3K9me3 أو H3K27me3 أو H3K36me2 أو H3K36me3 (الشكل 5C). p.H514A المحفز الخالي KDM5C لا يزيل الهستونات المنقاة على H3K4me2 / 3 ، ولا يفعل أيضًا p.M1_E165del. يُظهر p.D402Y و p.P480L KDM5C نشاطًا محدودًا لنزع الميثيلاز على H3K4me2 ، في حين أن إزالة ميثيل H3K4me3 بواسطة p.D402Y أو p.P480L يمكن مقارنتها مع تلك التي تظهر مع KDM5C من النوع البري. قد تكون الاختلافات في نشاط KDM5C الطافر على الهستونات مقارنة بالببتيدات بسبب وجود تعديلات إضافية على الهستونات المنقى التي قد تتداخل مع مثيلة H3K4.

لاستكمال هذه في المختبر فحوصات dememethylase ، قمنا بإفراط في التعبير عن KDM5C باستخدام علامات N-terminal (الشكل 6 أ) أو علامات C-terminal (المواد التكميلية ، الشكل S4) في الخلايا الليفية للتحكم وقمنا بتقييم H3K4me3 على مستوى خلية واحدة باستخدام الفحص المجهري المناعي. في الخلايا التي تعبر عن مستويات عالية من KDM5C من النوع البري ، تم تقليل تلطيخ H3K4me3 بشكل ملحوظ (الأسهم ، الشكل 6 أ ، المواد التكميلية ، الشكل S4). لم يكن هذا هو الحال في الخلايا التي تعبر عن مستويات عالية من المتحولة الحفزية pH514A KDM5C ، حيث كانت مستويات H3K4me3 متساوية عبر مجموعة الخلايا بغض النظر عن مستوى KDM5C (الشكل 6 أ ، المواد التكميلية ، الشكل S4). تسببت المستويات العالية من p.D402Y في انخفاض في H3K4me3 ، بينما ظل تلطيخ H3K4me3 مرتفعًا في الخلايا التي تفرط في التعبير عن p. تقلل الطفرات نشاط KDM5C في الجسم الحي. كل من نطاقي JmjN و ARID مطلوبان لنشاط demethylase (المواد التكميلية ، الشكل S4).

p480L و p.M1_E165del KDM5C تعرض نشاط demethylase للخطر خارج الجسم الحي، وتظهر الخلايا الليفية للمريض تغييرات التعبير الجيني المحلي. (أ) تم الإفراط في التعبير عن HA-Flag-KDM5C التي تؤوي طفرات مختلفة للمرضى في الخلايا الليفية Control-BJ وتم تقييم مستويات KDM5C (Flag) و H3K4me3 عن طريق التألق المناعي. أظهرت الخلايا ذات WT أو p.D402Y KDM5C انخفاضًا في تلطيخ H3K4me3 ، مما يدل على نشاط demethylase. لم يقلل التعبير الزائد عن p.H514A و p.P480L و p.M1_E165del KDM5C من مستويات H3K4me3. أسهم ، خلايا تعبر عن علامات KDM5C بمستويات عالية. (ب) لا تظهر مستخلصات هيستون الحمضية من الخلايا الليفية لجلد المريض أي تغيير ثابت في مثيلة H3K4 العالمية. H3 ، التحكم في التحميل. (ج) التغيرات في التعبير الجيني في الخلايا الليفية للمريض مقارنة بالضوابط. يتم عرض المتوسط ​​والانحراف المعياري لثلاث تجارب مستقلة (*ص & lt 0.05 مقارنة بـ Control-1 ، للطالب ر-اختبار). تم اكتشاف الحمض النووي الريبي باستخدام بادئات تمتد على تقاطعات exon-exon ، وتم تطبيعها مع جين التدبير المنزلي RSP18 ثم Control-1.

p480L و p.M1_E165del KDM5C تعرض نشاط demethylase للخطر خارج الجسم الحي، وتظهر الخلايا الليفية للمريض تغييرات التعبير الجيني المحلي. (أ) تم الإفراط في التعبير عن HA-Flag-KDM5C التي تؤوي طفرات مختلفة للمرضى في الخلايا الليفية Control-BJ وتم تقييم مستويات KDM5C (Flag) و H3K4me3 عن طريق التألق المناعي. أظهرت الخلايا ذات WT أو p.D402Y KDM5C انخفاضًا في تلطيخ H3K4me3 ، مما يدل على نشاط demethylase. لم يقلل التعبير الزائد عن p.H514A و p.P480L و p.M1_E165del KDM5C من مستويات H3K4me3. أسهم ، خلايا تعبر عن علامات KDM5C بمستويات عالية. (ب) لا تظهر مستخلصات هيستون الحمضية من الخلايا الليفية لجلد المريض أي تغيير ثابت في مثيلة H3K4 العالمية. H3 ، التحكم في التحميل. (ج) التغيرات في التعبير الجيني في الخلايا الليفية للمريض مقارنة بالضوابط. يتم عرض المتوسط ​​والانحراف المعياري لثلاث تجارب مستقلة (*ص & lt 0.05 مقارنة بـ Control-1 ، للطالب ر-اختبار). تم اكتشاف الحمض النووي الريبي باستخدام بادئات تمتد على تقاطعات exon-exon ، وتم تطبيعها مع جين التدبير المنزلي RSP18 ثم Control-1.

تظهر الخلايا الليفية للمريض تغيرات موضعية في التعبير الجيني ، ولكن ليس تغيرات عالمية في مثيلة هيستون

يتم تحديد مستويات مثيلة هيستون الخلوية الكلية بواسطة عدة ميثيل ترانسفيرازات مختلفة و demethylases. لتقييم تأثير انخفاض نشاط KDM5C في المرضى (الشكلان 5 و 6 أ) على مثيلة الهيستون العالمية في الجسم الحي، استخرجنا الهيستونات من الخلايا الليفية للمريض والسيطرة. لم تظهر البقع الغربية أي تغيير ثابت في مثيلة H3K4 في الخلايا الليفية للمريض مقارنةً بالضوابط ، مما يشير إلى ذلك KDM5C الطفرات لا تحدد المستويات العالمية لميثيل H3K4 (الشكل 6 ب).

لا تتطلب أنماط التعبير الجيني المعدلة في XLID بالضرورة تغييرًا عالميًا في مثيلة هيستون ، ولكن يمكن أن تنتج عن تغييرات محلية في مواقع محددة. هذا يتوافق مع زيادة التعبير (27) ، أو انخفاض مثيلة الحمض النووي (22) ، في جينات معينة في خطوط الخلايا اللمفاوية والدم من المرضى الذين يعانون من KDM5C الطفرات مقارنة مع الضوابط. اختبرنا هذه الجينات التي تم تحديدها مسبقًا لتغييرات التعبير في الخلايا الليفية للمريض مقارنة مع الضوابط باستخدام qRT-PCR (الشكل 6 ج). وجدنا ثلاثة جينات أظهرت تنظيمًا صعوديًا كبيرًا في الخلايا الليفية للمريض مقارنةً بالضوابط: EMILIN2 (واجهة ميكروفيبر الإيلاستين 2) ، TNFSF4 [عامل نخر الورم (يجند) فرد من العائلة الفائقة 4] و ZMYND12 (إصبع زنك من نوع MYND يحتوي على 12). تدعم هذه النتائج فكرة التغييرات المحلية المرتبطة بـ XLID في أنماط مثيلة H3K4 والتعبير الجيني في خلايا المريض.


مراجع

Kryshtafovych A و Fidelis K و Moult J: التقدم من CASP6 إلى CASP7. البروتينات. 2007 ، 69 (ملحق 8): 194-207. 10.1002 / حماية 21769.

Grabowski M ، Joachimiak A ، Otwinowski Z ، Minor W: الجينوميات الهيكلية: مواكبة المعرفة الموسعة لكون البروتين. بيول هيكل العملة للعملات. 2007 ، 17: 347-353. 10.1016 / j.sbi.2007.06.003.

Reeves GA ، Thornton JM: دمج البيانات البيولوجية من خلال الجينوم. همهمة مول جينيه. 2006 ، 15 (المواصفات رقم 1): R81-R87. 10.1093 / hmg / ddl086.

Prlic A و Down TA و Kulesha E و Finn RD و Kahari A و Hubbard TJ: دمج التسلسل والبيولوجيا الهيكلية مع DAS. المعلوماتية الحيوية BMC.2007، 8: 333-10.1186 / 1471-2105-8-333.

ترامونتانو أ: دور النمذجة الجزيئية في البحوث الطبية الحيوية. FEBS ليت. 2006 ، 580: 2928-2934. 10.1016 / j.febslet.2006.04.011.

Ashburner M، Ball CA، Blake JA، Botstein D، Butler H، Cherry JM، Davis AP، Dolinski K، Dwight SS، Eppig JT، Harris MA، Hill DP، Issel-Tarver L، Kasarskis A، Lewis S، Matese JC، Richardson JE ، Ringwald M ، Rubin GM ، Sherlock G: علم الوجود الجيني: أداة لتوحيد علم الأحياء. اتحاد علم الوجود الجيني. نات جينيه. 2000 ، 25: 25-29. 10.1038 / 75556.

Tress M و Cheng J و Baldi P و Joo K و Lee J و Seo JH و Lee J و Baker D و Chivian D و Kim D و Ezkurdia I: تقييم التنبؤات المقدمة لفئة التنبؤ بالمجال CASP7. البروتينات. 2007 ، 69 (ملحق 8): 137-151. 10.1002 / حماية 21675.

Altschul SF ، Gish W ، Miller W ، Myers EW ، Lipman DJ: أداة بحث المحاذاة المحلية الأساسية. J مول بيول. 1990 ، 215: 403-410.

Altschul SF و Madden TL و Schäffer AA و Zhang J و Zhang Z و Miller W و Lipman DJ: Gapped BLAST و PSI-BLAST: جيل جديد من برامج البحث في قواعد بيانات البروتين. الدقة الأحماض النووية. 1997 ، 25: 3389-3402. 10.1093 / nar / 25.17.3389.

Wu CH، Nikolskaya A، Huang H، Yeh LS، Natale DA، Vinayaka CR، Hu ZZ، Mazumder R، Kumar S، Kourtesis P، Ledley RS، Suzek BE، Arminski L، Chen Y، Zhang J، Cardenas JL، Chung S ، Castro-Alvear J، Dinkov G، Barker WC: PIRSF: نظام تصنيف الأسرة في مصدر معلومات البروتين. الدقة الأحماض النووية. 2004 ، D112-D114. 10.1093 / nar / gkh097. 32 قاعدة بيانات

Reid AJ، Yeats C، Orengo CA: يمكن الجمع بين طرق الكشف عن التماثل عن بعد لزيادة التغطية بنسبة 10٪ في منطقة منتصف الليل. المعلوماتية الحيوية. 2007 ، 23: 2353-2360. 10.1093 / المعلوماتية الحيوية / BTM355.

Apic G ، Gough J ، Teichmann SA: مجموعات المجال في البروتينات البدائية ، eubacterial و eukaryotic. J مول بيول. 2001 ، 310: 311-325. 10.1006 / جمبي.2001.4776.

مارشلر-باور أ ، أندرسون جي بي ، ديربيشاير إم كيه ، ديويز سكوت سي ، جونزاليس إن آر ، غوادز إم ، هاو إل ، هي إس ، هورويتز دي ، جاكسون دينار ، كي زد ، كريلوف دي ، لانشيكي سي جيه ، ليبرت كا ، ليو سي ، لو F ، Lu S ، Marchler GH ، Mullokandov M ، Song JS ، Thanki N ، Yamashita RA ، Yin JJ ، Zhang D ، Bryant SH: CDD: قاعدة بيانات مجال محفوظة لتحليل عائلة المجال التفاعلي. الدقة الأحماض النووية. 2007 ، D237-D240. 10.1093 / nar / gkl951. 35 قاعدة بيانات

Hulo N ، Bairoch A ، Bulliard V ، Cerutti L ، Cuche BA ، de Castro E ، Lachaize C ، Langendijk-Genevaux PS ، Sigrist CJ: 20 عامًا من PROSITE. الدقة الأحماض النووية. 2008 ، D245-D249. 36 قاعدة بيانات

Finn RD و Tate J و Mistry J و Coggill PC و Sammut SJ و Hotz HR و Ceric G و Forslund K و Eddy SR و Sonnhammer EL و Bateman A: قاعدة بيانات عائلات بروتين Pfam. الدقة الأحماض النووية. 2008 ، D281-D288. 36 قاعدة بيانات

Letunic I، Copley RR، Pils B، Pinkert S، Schultz J، Bork P: SMART 5: المجالات في سياق الجينومات والشبكات. الدقة الأحماض النووية. 2006 ، D257-D260. 10.1093 / nar / gkj079. 34 قاعدة بيانات

مصدر البروتين العالمي (UniProt). الدقة الأحماض النووية. 2008 ، D190-D195. 36 قاعدة بيانات

مولدر نيوجيرسي ، أبويلر آر ، أتوود تي كيه ، بيروش أ ، بيتمان أ ، بينز دي ، بورك بي ، بيلارد الخامس ، سيروتي إل ، كوبلي آر ، كورسيل إي ، داس يو ، دوجيرتي إل ، ديبلي إم ، فين آر ، فليشمان دبليو ، جوف جي ، هفت د ، هولو إن ، هنتر إس ، كان دي ، كانابين أ ، كيجاريوال أ ، لابارجا أ ، لانجينديجك جينيفوكس بي إس ، لونسدال دي ، لوبيز آر ، ليتونيك الأول ، ماديرا إم ، ماسلين ج ، وآخرون: التطورات الجديدة في InterPro قاعدة البيانات. الدقة الأحماض النووية. 2007 ، D224-D228. 10.1093 / nar / gkl841. 35 قاعدة بيانات

Yeats C، Lees J، Reid A، Kellam P، Martin N، Liu X، Orengo C: Gene3D: شرح هيكلي ووظيفي شامل للجينومات. الدقة الأحماض النووية. 2008 ، D414-D418. 36 قاعدة بيانات

Wilson D و Madera M و Vogel C و Chothia C و Gough J: قاعدة بيانات SUPERFAMILY في عام 2007: العائلات والوظائف. الدقة الأحماض النووية. 2007 ، D308-D313. 10.1093 / nar / gkl910. 35 قاعدة بيانات

Orengo CA ، Michie AD ، Jones S ، Jones DT ، Swindells MB ، Thornton JM: CATH - تصنيف هرمي لهياكل مجال البروتين. بنية. 1997 ، 5: 1093-1108. 10.1016 / S0969-2126 (97) 00260-8.

Murzin AG ، Brenner SE ، Hubbard T ، Chothia C: SCOP: تصنيف هيكلي لقاعدة بيانات البروتينات للتحقيق في التسلسلات والهياكل. J مول بيول. 1995 ، 247: 536-540. 10.1006 / جمبي .1995.0159.

Tatusov RL و Fedorova ND و Jackson JD و Jacobs AR و Kiryutin B و Koonin EV و Krylov DM و Mazumder R و Mekhedov SL و Nikolskaya AN و Rao BS و Smirnov S و Sverdlov AV و Vasudevan S و Wolf YI و Yin JJ و Natale DA : قاعدة بيانات COG: نسخة محدثة تتضمن حقيقيات النوى. المعلوماتية الحيوية BMC. 2003 ، 4: 41-10.1186 / 1471-2105-4-41.

Kaplan N و Sasson O و Inbar U و Friedlich M و Fromer M و Fleischer H و Portugaly E و Linial N و Linial M: ProtoNet 4.0: تصنيف هرمي لمليون تسلسل بروتين. الدقة الأحماض النووية. 2005 ، D216-D218. 33 قاعدة بيانات

Petryszak R ، Kretschmann E ، Wieser D ، Apweiler R: القوة التنبؤية لقاعدة بيانات CluSTr. المعلوماتية الحيوية. 2005 ، 21: 3604-3609. 10.1093 / المعلوماتية الحيوية / bti542.

Krause A و Stoye J و Vingron M: مجموعات هرمية واسعة النطاق لتسلسلات البروتين. المعلوماتية الحيوية BMC. 2005، 6: 15-10.1186 / 1471-2105-6-15.

Bru C و Courcelle E و Carrere S و Beausse Y و Dalmar S و Kahn D: قاعدة بيانات ProDom لعائلات مجال البروتين: مزيد من التركيز على الأبعاد الثلاثية. الدقة الأحماض النووية. 2005 ، D212-D215. 33 قاعدة بيانات

Portugaly E ، Linial N ، Linial M: EVEREST: مجموعة من مجالات البروتين المحفوظة التطورية. الدقة الأحماض النووية. 2007 ، D241-D246. 10.1093 / nar / gkl850. 35 قاعدة بيانات

Watson JD، Sanderson S، Ezersky A، Savchenko A، Edwards A، Orengo C، Joachimiak A، Laskowski RA، Thornton JM: نحو تنبؤ وظيفي قائم على الهيكل المؤتمت بالكامل في الجينوميات الهيكلية: دراسة حالة. J مول بيول. 2007 ، 367: 1511-1522. 10.1016 / j.jmb.2007.01.063.

Chothia C ، Lesk AM: العلاقة بين اختلاف التسلسل والبنية في البروتينات. EMBO J. 1986 ، 5: 823-826.

Taylor WR ، Orengo CA: محاذاة بنية البروتين. J مول بيول. 1989 ، 208: 1-22. 10.1016 / 0022-2836 (89) 90084-3.

Redfern OC و Harrison A و Dallman T و Pearl FM و Orengo CA: CATHEDRAL: خوارزمية سريعة وفعالة للتنبؤ بالثنيات وحدود المجال من هياكل البروتين متعددة المجالات. بلوس كومبوت بيول. 2007 ، 3: e232-10.1371 / journal.pcbi.0030232.

Holm L ، Sander C: مقارنة بنية البروتين عن طريق محاذاة مصفوفات المسافة. J مول بيول. 1993 ، 233: 123-138. 10.1006 / جمبي / 1993.1489.

Krissinel E ، Henrick K: مطابقة البنية الثانوية (SSM) ، أداة جديدة لمحاذاة بنية البروتين السريعة في ثلاثة أبعاد. Acta Crystallogr D Biol Crystallogr. 2004 ، 60: 2256-2268. 10.1107 / S0907444904026460.

Madej T، Gibrat JF، Bryant SH: ربط قاعدة بيانات لبروتينات البروتين. البروتينات. 1995 ، 23: 356-369. 10.1002 / حماية .340230309.

Shindyalov IN ، Bourne PE: محاذاة بنية البروتين عن طريق الامتداد التوافقي التدريجي (CE) للمسار الأمثل. هندسة البروتين. 1998 ، 11: 739-747. 10.1093 / بروتين / 11.9.739.

Kolodny R ، Koehl P ، Levitt M: تقييم شامل لطرق محاذاة بنية البروتين: التسجيل بالمقاييس الهندسية. J مول بيول. 2005 ، 346: 1173-1188. 10.1016 / j.jmb.2004.12.032.

Ye Y، Godzik A: محاذاة مرنة للهيكل عن طريق تسلسل أزواج شظية متحاذية تسمح بالالتواءات. المعلوماتية الحيوية. 2003، 19 (ملحق 2): ii246-255.

Berman HM، Westbrook J، Feng Z، Gilliland G، Bhat TN، Weissig H، Shindyalov IN، Bourne PE: The Protein Data Bank. الدقة الأحماض النووية. 2000 ، 28: 235-242. 10.1093 / nar / 28.1.235.

Polacco BJ ، Babbitt PC: الاكتشاف الآلي للزخارف ثلاثية الأبعاد لتعليق وظيفة البروتين. المعلوماتية الحيوية. 2006 ، 22: 723-730. 10.1093 / المعلوماتية الحيوية / btk038.

Kleywegt GJ: التعرف على الأشكال المكانية في هياكل البروتين. J مول بيول. 1999 ، 285: 1887-1897. 10.1006 / جمبي.1998.2393.

Wangikar PP و Tendulkar AV و Ramya S و Mali DN و Sarawagi S: تم الكشف عن المواقع الوظيفية في عائلات البروتين من خلال نهج نظري موضوعي وآلي للرسم البياني. J مول بيول. 2003 ، 326: 955-978. 10.1016 / S0022-2836 (02) 01384-0.

Laskowski RA ، Luscombe NM ، Swindells MB ، Thornton JM: شقوق البروتين في التعرف الجزيئي والوظيفة. علوم البروتين. 1996 ، 5: 2438-2452.

Laskowski RA: SURFNET: برنامج لتصور الأسطح الجزيئية والتجاويف والتفاعلات بين الجزيئات. J مول الرسم البياني. 1995 ، 13: 323-330. 10.1016 / 0263-7855 (95) 00073-9.

Landau M ، Mayrose I ، Rosenberg Y ، Glaser F ، Martz E ، Pupko T ، Ben-Tal N: ConSurf 2005: إسقاط درجات الحفظ التطوري للمخلفات على هياكل البروتين. الدقة الأحماض النووية. 2005 ، 33: W299-W302. 10.1093 / nar / gki370.

Glaser F ، Rosenberg Y ، Kessel A ، Pupko T ، Ben-Tal N: قاعدة بيانات ConSurf-HSSP: رسم خرائط الحفظ التطوري بين المتماثلات على هياكل PDB. البروتينات. 2005 ، 58: 610-617. 10.1002 / بروت 20305.

Binkowski TA و Freeman P و Liang J: pvSOAR: الكشف عن أنماط سطحية متشابهة لأسطح الجيب والفراغ لبقايا الأحماض الأمينية على البروتينات. الدقة الأحماض النووية. 2004 ، 32: W555-W558. 10.1093 / nar / gkh390.

Dundas J و Ouyang Z و Tseng J و Binkowski A و Turpaz Y و Liang J: CASTp: الأطلس المحسوب للتضاريس السطحية للبروتينات مع رسم الخرائط الهيكلية والطبوغرافية للمخلفات المشروحة وظيفيًا. الدقة الأحماض النووية. 2006 ، 34: W116-W118. 10.1093 / nar / gkl282.

Bagley SC ، Altman RB: يميز البيئة المكروية المحيطة بمواقع البروتين. علوم البروتين. 1995 ، 4: 622-635.

Shulman-Peleg A و Nussinov R و Wolfson HJ: SiteEngines: التعرف على مواقع الربط وواجهات البروتين والبروتين ومقارنتها. الدقة الأحماض النووية. 2005 ، 33: W337-W341. 10.1093 / نار / gki482.

Sasin JM و Godzik A و Bujnicki JM: SURF'S UP! - تصنيف البروتين عن طريق المقارنات السطحية. J Biosci. 2007 ، 32: 97-100. 10.1007 / s12038-007-0009-0.

Porter CT ، Bartlett GJ ، Thornton JM: أطلس الموقع التحفيزي: مورد للمواقع المحفزة والمخلفات المحددة في الإنزيمات باستخدام البيانات الهيكلية. الدقة الأحماض النووية. 2004 ، 32: D129-D133. 10.1093 / نار / gkh028.

Ivanisenko VA و Pintus SS و Grigorovich DA و Kolchanov NA: PDBSiteScan: برنامج للبحث عن مواقع التعديل النشطة والملزمة وما بعد الترجمة في الهياكل ثلاثية الأبعاد للبروتينات. الدقة الأحماض النووية. 2004 ، 32: W549-W554. 10.1093 / nar / gkh439.

Ivanisenko VA و Pintus SS و Grigorovich DA و Kolchanov NA: PDBSite: قاعدة بيانات للهيكل ثلاثي الأبعاد للمواقع الوظيفية للبروتين. الدقة الأحماض النووية. 2005 ، 33: D183-D187. 10.1093 / nar / gki105.

George RA ، Spriggs RV ، Bartlett GJ ، Gutteridge A ، MacArthur MW ، Porter CT ، Al-Lazikani B ، Thornton JM ، Swindells MB: شرح توضيحي فعال للوظيفة من خلال حفظ المخلفات التحفيزية. بروك ناتل أكاد علوم الولايات المتحدة الأمريكية. 2005 ، 102: 12299-12304. 10.1073 / pnas.0504833102.

Laskowski RA ، Watson JD ، Thornton JM: ProFunc: خادم للتنبؤ بوظيفة البروتين من بنية ثلاثية الأبعاد. الدقة الأحماض النووية. 2005 ، 33: W89-W93. 10.1093 / نار / gki414.

Stark A، Russell RB: شرح توضيحي في ثلاثة أبعاد. PINTS: الأنماط في الهياكل الجامعية غير المتجانسة. الدقة الأحماض النووية. 2003 ، 31: 3341-3344. 10.1093 / نار / gkg506.

Lichtarge O ، Bourne HR ، Cohen FE: طريقة تتبع تطورية تحدد الأسطح الملزمة المشتركة لعائلات البروتين. J مول بيول. 1996 ، 257: 342-358. 10.1006 / جمبي.1996.0167.

كريستنسن دي إم ، وارد آر إم ، ليسيفسكي إيه إم ، إردين إس ، تشن بي ، فوفانوف في واي ، كيميل إم ، كافراكي لي ، ليشتارج أو: توقع وظيفة الإنزيم بناءً على قوالب ثلاثية الأبعاد للأحماض الأمينية المهمة تطوريًا. المعلوماتية الحيوية BMC. 2008، 9: 17-10.1186 / 1471-2105-9-17.

Ward RM و Erdin S و Tran TA و Kristensen DM و Lisewski AM و Lichtarge O: إزالة البروتين الهيكلي من خلال المقارنة المتبادلة للميزات الهيكلية الهامة من الناحية التطورية. بلوس واحد. 2008 ، 3: e2136-10.1371 / journal.pone.0002136.

Herrgard S، Cammer SA، Hoffman BT، Knutson S، Gallina M، Speir JA، Fetrow JS، Baxter SM: التنبؤ بالتأثيرات الوظيفية الضارة لطفرات الأحماض الأمينية باستخدام مكتبة من واصفات الوظائف القائمة على البنية. البروتينات. 2003 ، 53: 806-816. 10.1002 / بروت 10458.

Pal D ، Eisenberg D: استنتاج وظيفة البروتين من بنية البروتين. بنية. 2005 ، 13: 121-130. 10.1016 / j.str.2004.10.015.

Salwinski L، Miller CS، Smith AJ، Pettit FK، Bowie JU، Eisenberg D: قاعدة بيانات تفاعل البروتينات: تحديث 2004. الدقة الأحماض النووية. 2004 ، 32: D449-D451. 10.1093 / nar / gkh086.

Friedberg I، Harder T، Godzik A: JAFA: خادم تعريف لتعليق وظيفة البروتين. الدقة الأحماض النووية. 2006 ، 34: W379-W381. 10.1093 / nar / gkl045.

von Mering C و Krause R و Snel B و Cornell M و Oliver SG و Fields S و Bork P: تقييم مقارن لمجموعات البيانات واسعة النطاق لتفاعلات البروتين والبروتين. طبيعة سجية. 2002 ، 417: 399-403. 10.1038 / Nature750.

Pagel P ، Kovac S ، Oesterheld M ، Brauner B ، Dunger-Kaltenbach I ، Frishman G ، Montrone C ، Mark P ، Stümpflen V ، Mewes HW ، Ruepp A ، Frishman D: قاعدة بيانات تفاعل البروتين البروتيني للثدييات MIPS. المعلوماتية الحيوية. 2005 ، 21: 832-834. 10.1093 / المعلوماتية الحيوية / bti115.

Hart GT ، Ramani AK ، Marcotte EM: ما مدى اكتمال شبكات تفاعل الخميرة والبروتين البشري الحالية ؟. جينوم بيول. 2006، 7: 120-10.1186 / gb-2006-7-11-120.

Aloy P ، Russell RB: عشرة آلاف تفاعل لعالم الأحياء الجزيئي. Nat Biotechnol. 2004 ، 22: 1317-1321. 10.1038 / nbt1018.

Finn RD ، Marshall M ، Bateman A: iPfam: تصور تفاعلات البروتين البروتين في PDB في دقة المجال والأحماض الأمينية. المعلوماتية الحيوية. 2005 ، 21: 410-412. 10.1093 / المعلوماتية الحيوية / bti011.

Stein A، Russell RB، Aloy P: 3did: مجالات البروتين المتفاعلة ذات البنية ثلاثية الأبعاد المعروفة. الدقة الأحماض النووية. 2005 ، 33: D413-D417. 10.1093 / نار / gki037.

Riley R و Lee C و Sabatti C و Eisenberg D: استنتاج تفاعلات مجال البروتين من قواعد بيانات البروتينات المتفاعلة. جينوم بيول. 2005 ، 6: R89-10.1186 / gb-2005-6-10-r89.

Jothi R و Cherukuri PF و Tasneem A و Przytycka TM: يكشف التحليل التطوري المشترك للمجالات في تفاعلات البروتينات عن رؤى حول تفاعلات المجال التي تتوسط تفاعلات البروتين والبروتين. J مول بيول. 2006 ، 362: 861-875. 10.1016 / j.jmb.2006.07.072.

Pagel P ، Wong P ، Frishman D: خريطة تفاعل المجال على أساس التنميط النشوء والتطور. J مول بيول. 2004 ، 344: 1331-1346. 10.1016 / j.jmb.2004.10.019.

Pagel P ، Oesterhold M ، Tovstukhina O ، Strack N ، Stumpflen V ، Frishman D: DIMA 2.0 - تفاعلات المجال المتوقعة والمعروفة. الدقة الأحماض النووية. 2008 ، D651-D655. 36 قاعدة بيانات

Raghavachari B ، Tasneem A ، Przytycka TM ، Jothi R: DOMINE: قاعدة بيانات لتفاعلات مجال البروتين. الدقة الأحماض النووية. 2008 ، D656-D661. 36 قاعدة بيانات

مولت جي ، بيدرسن جيه تي ، جودسون آر ، فيديليس ك: تجربة واسعة النطاق لتقييم طرق التنبؤ ببنية البروتين. البروتينات. 1995 ، 23: ii-v. 10.1002 / حماية .340230303.

سورو S ، ترامونتانو أ: التنبؤ بوظيفة البروتين في CASP6. البروتينات. 2005، 61 (ملحق 7): 201-213. 10.1002 / حماية 20738.

Pellegrini-Calace M ، Soro S ، Tramontano A: إعادة النظر في التنبؤ بوظيفة البروتين في CASP6. FEBS J.2006 ، 273: 2977-2983. 10.1111 / j.1742-4658.2006.05309.x.


6 التعاريف

يجب أن تساعد التعريفات التالية المستخدم في فهم ما يتم تسميته ، وفي فهم المبادئ التي تقوم عليها هذه الإرشادات.

6.1 الجين

الجين هو وحدة وظيفية ، عادة ما تقوم بتشفير البروتين أو الحمض النووي الريبي ، والتي يمكن متابعة ميراثها تجريبيًا. عادة ما يتم تقييم الوراثة في التهجينات الجينية ، ولكن تحديد الجين في الخرائط الوراثية الخلوية أو الفيزيائية هو وسيلة أخرى لرسم خرائط موقع الجين. يمكن أيضًا الاستدلال على وجود الجين في حالة عدم وجود أي معلومات خريطة جينية أو فيزيائية ، مثل تسلسل cDNA.

6.2 الجين الكاذب

تسلسل يشبه إلى حد بعيد جينًا وظيفيًا معروفًا ، في مكان آخر داخل الجينوم ، وهو غير وظيفي نتيجة لطفرات (عادةً عدة) تمنع نسخه أو ترجمته (أو كليهما). بشكل عام ، تنتج الجينات الخادعة إما من النسخ العكسي لنسخة من نظيرها "الطبيعي" (في هذه الحالة يفتقر الجين الكاذب عادةً إلى الإنترونات ويتضمن ذيلًا متعدد (A) يُسمى غالبًا الجينات الكاذبة المعالجة) أو من إعادة التركيب (في هذه الحالة يكون الجين الزائف عادةً ما يكون تكرارًا مترادفًا لشبهه "الطبيعي"). لاحظ أنه في الفئران والجرذان ، قد يكون الجين جينًا كاذبًا في سلالة فطرية واحدة ولكن ليس في سلالة أخرى.

6.3 المكان

الموضع هو نقطة في الجينوم ، يتم تحديدها بواسطة علامة ، والتي يمكن تعيينها ببعض الوسائل. لا يتوافق بالضرورة مع الجين ، فقد يكون ، على سبيل المثال ، مقطع DNA مجهول الهوية غير مشفر أو ميزة وراثية خلوية. قد يحتوي جين واحد على عدة مواضع بداخله (كل منها محدد بعلامات مختلفة) ويمكن فصل هذه العلامات في تجارب رسم الخرائط الجينية أو الفيزيائية. في مثل هذه الحالات ، من المفيد تحديد هذه المواضع المختلفة ، ولكن عادةً ما يجب استخدام اسم الجين لتعيين الجين نفسه ، لأن هذا عادةً ما ينقل معظم المعلومات.

6.4 علامة

العلامة هي الوسيلة التي يتم من خلالها تحديد الجين أو الموضع. تعتمد العلامة على المقايسة ، والتي يمكن ، على سبيل المثال ، تحديد نمط ظاهري متحور أو وجود نشاط إنزيم أو شريط بروتين أو جزء من الحمض النووي. يجب أن يُظهر الاختبار التباين الجيني للعلامة لتعيين الموقع على الخريطة الجينية ولكن ليس لوضعه على الخريطة المادية.

6.5 أليل

نسختان من جين أو موضع جسمي على كروموسومات الأم والأب هما الأليلات. إذا كان الأليلين متطابقين ، يكون الحيوان متماثل الزيجوت في هذا المكان. عندما يمكن اكتشاف المتغيرات الموروثة وراثيًا للجين أو الموضع بأي وسيلة ، فإن الأليلات المختلفة تتيح رسم الخرائط الجينية. يمكن لكروموسوم واحد أن يحمل أليلًا واحدًا فقط ، باستثناء حالات الازدواج أو الحذف أو التثلث الصبغي ، يحمل الحيوان أليلين صبغيين. على وجه الخصوص ، الجين المحور الذي يتم إدخاله عشوائيًا في الجينوم ليس أليلًا للموقع الداخلي ، وتسمى الحالة hemizygous إذا كان الجين المحور موجودًا فقط في واحدة من مجموعتي كروموسوم الوالدين. على النقيض من ذلك ، فإن الجين المعدل عن طريق استهداف الموضع الداخلي هو أليل ويجب تسميته على هذا النحو.

6.6 البديل الأليلي

المتغيرات الأليلية هي الاختلافات بين الأليلات ، ويمكن اكتشافها عن طريق أي فحص. على سبيل المثال ، يمكن اكتشاف الاختلافات في تسلسل الحمض النووي المجهول مثل تعدد أشكال طول التسلسل البسيط (SSLP) أو تعدد أشكال النوكليوتيدات المفردة (SNPs). تشمل الأنواع الأخرى من المتغيرات الاختلافات في الوزن الجزيئي للبروتين أو الشحنة ، أو الاختلافات في نشاط الإنزيم ، أو الاختلافات في التشكل أحادي السلسلة (SSCP). العديد من المتغيرات الأليلية ، ولا سيما متغيرات الحمض النووي ، لا تمنح أي نمط ظاهري خارجي للحيوان. غالبًا ما يطلق على هذه المتغيرات & # 147polymorphisms & # 148 على الرغم من أن هذا المصطلح ، بالمعنى الدقيق للكلمة ، ينطبق فقط على المتغيرات التي يزيد معدل تكرارها عن 1 ٪ في السكان.

6.7 متغير لصق أو لصق بديل

ينتج عن التضفير البديل للجين أشكال مختلفة من الرنا المرسال يتم تحديدها من خلال exons (أو أجزاء من exons). وبالتالي يمكن إنتاج منتج بروتين بديل واحد أو أكثر بواسطة أليل واحد من الجين.من بين الأليلات المختلفة ، قد تختلف أشكال اللصق البديلة أو لا ، اعتمادًا على ما إذا كان اختلاف التسلسل بين الأليلات يؤثر على آلية الربط العادية وينتج عنه اختلافات في استخدام exon (أو exon الجزئي). على سبيل المثال ، قد ينتج الأليل A mRNAs من لصق شكل 1 و 2 و 3 بينما قد ينتج الأليل B mRNAs من لصق شكل 1 و 2 و 4 وقد ينتج Allele C mRNAs من لصق شكل 1 و 2 و 3. في هذا في الحالة ، يجب أن يختلف كل من الأليلات A و B و C حسب التعريف في تسلسل الحمض النووي الخاص بهم. ومع ذلك ، يجب أن يتضمن الفرق بين الأليل B مقابل الأليلات A و C اختلافًا في التسلسل يؤثر على نمط التضفير للجين.

6.8 الطفرة

الطفرة هي فئة معينة من الأليل المتغير الذي عادةً ما يمنح فرقًا يمكن تحديده ظاهريًا إلى النمط الظاهري المرجعي "النوع البري". ومع ذلك ، في بعض الحالات ، كما هو الحال عند استخدام إعادة التركيب المتماثل لاستهداف الجين ، قد لا ينتج النمط الظاهري المحدد بسهولة على الرغم من أن الجين قد يصبح غير وظيفي. في مثل هذه الحالات ، ومع ذلك ، يشار إلى الجينات المستهدفة باسم الأليلات الطافرة.

6.9 المسيطر والمتنحي

تشير السائدة والمتنحية إلى طبيعة وراثة الأنماط الظاهرية ، وليس إلى الجينات أو الأليلات أو الطفرات. النمط الظاهري المتنحي هو النمط الذي يتم اكتشافه فقط عندما يكون للأليلين متغير أو طفرة معينة. يمكن اكتشاف النمط الظاهري السائد عند وجود أليل متغير واحد فقط. إذا كان من الممكن اكتشاف كلا الأليلين في وقت واحد عن طريق الفحص ، فعندئذٍ يكونان سائدين. على سبيل المثال ، فإن الفحص الذي يكتشف تباين الحمض النووي أو البروتين سيكشف بشكل شبه دائم عن الوراثة السائدة ، حيث يتم اكتشاف كلا الأليلين. إذا كانت الطفرة تنتج نمطًا ظاهريًا في الزيجوت المتغاير الذي يكون وسيطًا بين العادي المتماثل والمتحور ، يُشار إلى النمط الظاهري على أنه شبه سائد. قد تمنح طفرة واحدة كلا من النمط الظاهري السائد والمتنحي. على سبيل المثال ، تصحيح الماوس (دكتوراه) الطفرة لها نمط ظاهري تصبغ متغاير الزيجوت (سائد) ولكن أيضًا نمط ظاهري متماثل (متنحي) مميت. نظرًا لتطبيق المصطلحات على الطرز المظهرية وليس على الجينات أو الأليلات ، فعندئذٍ في الحالة التي يكون فيها للجين عدة أليلات متحولة ، يمكن لكل منها أن يمنح نمطًا ظاهريًا سائدًا لبعض الطرز المظهرية ، ولكنه متنحي إلى أنماط ظاهرية أخرى بسبب أليلات أخرى.

الاختراق هو مقياس كمي لعدد المرات التي يحدث فيها النمط الظاهري في مجتمع ما والتعبيرية هي مقياس لمدى قوة التعبير عن النمط الظاهري في الفرد. خاصة في فصل التهجينات ، أو عندما يكون هناك تأثير عتبة على مظاهر النمط الظاهري ، توفر هذه المقاييس طرقًا إضافية لوصف كيف تؤدي مجموعات أليلية معينة إلى نمط ظاهري.

6.10 النمط الجيني

النمط الجيني هو وصف التركيب الجيني للحيوانات ، عادةً من حيث الأليلات المعينة في أماكن معينة. قد يشير إلى جينات مفردة أو مواقع أو العديد. لا يمكن تحديد النمط الجيني إلا عن طريق فحص النمط الظاهري ، بما في ذلك اختبار التزاوج للكشف عن ناقلات الطفرات المتنحية. بالمعنى الدقيق للكلمة ، حتى التحديد المباشر لمتغيرات الحمض النووي يقوم بمعايرة النمط الظاهري وليس النمط الجيني لأنه يعتمد على اختبار معين ، على الرغم من أنه قريب جدًا من النمط الجيني بحيث يعمل كبديل.

6.11 النمط الظاهري

النمط الظاهري هو نتيجة التفاعل بين النمط الجيني والبيئة ويمكن تحديده عن طريق أي مقايسة.

6.12 مواقع السمات الكمية (QTLs)

روابط الصفات الكمية (QTL) هي مواقع متعددة الأشكال تحتوي على أليلات ، والتي تؤثر بشكل مختلف على التعبير عن السمات المظهرية الموزعة باستمرار. عادة ما يتم وصف هذه العلامات من خلال الارتباط الإحصائي للتغير الكمي في سمات النمط الظاهري المعينة التي يتم التحكم فيها من خلال العمل التراكمي للأليلات في مواقع متعددة.

6.13 النمط الفردي

النمط الفرداني هو ارتباط الأليلات المرتبطة جينيًا ، كما هو موجود في الأمشاج. قد تكون مزيجًا من أي نوع من الواسمات ، ويمكن أن تمتد على مسافات كبيرة يمكن فصلها وراثيًا ، أو تكون ضمن مسافة قصيرة مثل داخل الجين ولا يتم فصلها بشكل طبيعي.

6.14 Homolog

تكون الجينات متماثلة إذا تطورت بشكل ملحوظ من سلف مشترك. لاحظ أن الجينات إما متجانسة أو لا توجد درجات من التنادد! على سبيل المثال ، جميع جينات الغلوبين ، والميوغلوبين ، متجانسة ، على الرغم من أن بعضها يرتبط ارتباطًا وثيقًا ببعضها البعض أكثر من البعض الآخر. عندما يكون قياس الارتباط بين التسلسلات مطلوبًا ، يجب استخدام النسبة المئوية للهوية أو التشابه.

6.15 تقويم العظام

الجينات في الأنواع المختلفة هي أخصائيو تقويم العظام إذا تطورت من جين سلف مشترك واحد. على سبيل المثال ، جينات بيتا غلوبين من الفئران والجرذان والبشر هي أخصائيو تقويم العظام. لاحظ أن العديد من الجينات في الفأر أو الجرذ قد يكون لها طبيب تقويم واحد في نوع آخر والعكس صحيح.

6.16 بارالوج

الجينات Paralogous هي جينات داخل نفس النوع نشأت من سلف مشترك عن طريق الازدواجية والتباعد اللاحق. على سبيل المثال ، جينات الفأر ألفا غلوبين وبيتا غلوبين هي نظائر بارالوج.


هيكل APOB الجين /APOB تحرير مرنا

في البشر البالغين ، يتم إنتاج apoB-100 في الكبد (4536 حمض أميني 100٪) و apoB-48 في الأمعاء (2152 حمضًا أمينيًا بنسبة 48٪) عبر عملية تحرير فريدة من الرنا المرسال (1). 43 كيلو بايت APOB يقع الجين على الذراع القصيرة للكروموسوم البشري 2. ويتكون من 29 إكسون ، منها إكسون 26 ، عند 7572 نقطة أساس ، هو الأكبر ويرمز أكثر من نصف البروتين كامل الطول. تؤدي عملية تحرير ما بعد النسخ الجديدة التي تحدث على mRNA بسعة 14.5 كيلو بايت إلى إنتاج apoB-48. باختصار ، يرتبط مركب سيتيدين ديميناز الخاص بالـ RNA ، مركب تحرير إنزيم apoB mRNA 1 (apobec-1) ، ويعمل على جزيء السيتوزين في القاعدة 6666 من الرنا المرسال لإنشاء اليوراسيل ، مما يؤدي إلى تكوين الجلوتامين 2153 (CAA). ) كودون يتم تحويله إلى كودون إنهاء (UAA) (2). يتم إنتاج Apobec-1 فقط في الخلايا الظهارية المعوية عند البالغين. إن عملية التحرير هي التي تحدد شكل apoB المراد تصنيعه ، والذي بدوره يحدد نوع البروتين الدهني ، سواء كان chylomicron أو جسيم VLDL ، الذي سيتم تجميعه.


شكل 1

الشكل 1. تمثيلات تخطيطية لطفرات تشبع مسح الموقع (SSSM) ، والطفرات الموجهة متعددة المواقع (MSDM) ، والتوليف الجيني عن طريق سير عمل التوليف الدقيق القائم على PCR (PAS). (أ ، من اليسار إلى اليمين) سير عمل SSSM: تتضمن مدخلات المستخدم تسلسل بلازميد (أزرق) مع جين مهم ، وقائمة بمواضع الأحماض الأمينية المطلوب تغييرها (المربعات الحمراء ، تم تصنيف 3 مواقع فقط من أجل البساطة) ، الاشعال المرافقة للأمام والخلف (Ffwd و Frev ، أسهم أرجوانية) ، كودون متدهور (مميز بعلامة "X") ، وقائمة بالمعلمات المرغوبة (تيم، محتوى GC ، الاشعال المرافقة ، إلخ.، غير ظاهر). ينتج Mutation Maker أزواجًا من البادئات المطفرة المتراكبة للأمام والخلف (أصفر) لتفاعلات تفاعل البوليميراز المتسلسل المتوازية المتعددة في لوحات 96 بئر متعددة (السهم الأخضر). لإنشاء شظايا الجين N و C ، يتم إجراء تفاعلات PCR أولاً بشكل منفصل وبالتوازي لكل موقع (الصفوف العلوية والسفلية ، على التوالي) باستخدام الطفرات (الصفراء مع المربعات الحمراء) وأزواج التمهيدي المرافقة (الأرجواني) والقالب الجيني ( أزرق). يتم بعد ذلك حياكة شظايا N- و C- المتداخلة معًا باستخدام بادئات مرافقة (أرجوانية) عبر تفاعل PCR ثانٍ (SOEing ، Splicing by Overlap Extension) ينتج متغيرات جينية كاملة الطول. يتم تجميعها لاحقًا لإنشاء مكتبة جينات ، حيث يحمل كل متغير بديلًا عشوائيًا للأحماض الأمينية في موضع محدد. بعد ذلك ، يتم استنساخ المكتبة في ناقل تعبير (دوائر زرقاء). (B ، من اليسار إلى اليمين) سير عمل MSDM: يتضمن مدخلات المستخدم الجينات ذات الأهمية وقائمة المخلفات والطفرات المستهدفة (المربعات الحمراء ، يتم عرض 3 طفرات فقط من أجل البساطة) وقائمة من المعلمات (تيم، GC ، الكائن الحي المضيف ، انحلال ، إلخ.، غير ظاهر). ينتج Mutation Maker مجموعة من البادئات المطفرة أحادية الاتجاه (صفراء مع مربعات حمراء) بالإضافة إلى بادئات تحمل أكواد أبوية (مربعات صفراء فاتحة على مواد أولية) تغطي موقعًا مستهدفًا واحدًا أو أكثر. يمكن استخدام البادئات الناتجة في تجارب MSDM باستخدام مجموعة أدوات الطفرات الموجهة متعددة المواقع QuikChange lightning (Agilent) لإنتاج مكتبة اندماجية متنوعة (دوائر زرقاء). (ج ، من اليسار إلى اليمين) من جديد سير عمل التوليف الجيني باستخدام بروتوكول التوليف الدقيق (PAS) القائم على PCR. يتكون الإدخال إلى صانع الطفرات من الجين المهم (الخط الأزرق) مع قائمة المخلفات والطفرات المستهدفة (المربعات الحمراء ، كما هو موضح) بالإضافة إلى قائمة القيود (تيم، GC ، الكائن الحي المضيف ، الدوافع لاستبعاد ، الانحطاط ، إلخ.، غير ظاهر). ينتج Mutation Maker مجموعة من القلة المتراكبة (الصفراء) التي قد تحمل طفرات ومجموعات كودون أبوية (مربعات حمراء وصفراء فاتحة ، على التوالي) في أجزاءها غير المتداخلة. يمكن تجميع هذه القلة إلى متغيرات جينية كاملة الطول (خطوط زرقاء) ، كل منها يحمل مجموعات طفرات مختلفة يمكن استنساخها لاحقًا في ناقل تعبير (دوائر زرقاء).


شاهد الفيديو: 46 Indicatoren - scheikunde - (قد 2022).